AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00450_tpal_reg_100.orf -o00450_tpal_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 TP0794 53 S-adenosylmethionine synthetase (metK) #2 TP0798 32 methionyl-tRNA synthetase (metG) Motif number 1 CCTTTACTCCTAGGTTCAGTG 1 2 1 CTTTACTCCT 0.999077 -52 CACTGTACTCCTCGATTCAAAA 1 42 0 CTGTACTCCT 0.998901 -12 AGCGTTTCCTACTCTGATTTAAA 2 20 0 GTTTCCTACT 0.994519 -13 ********** Masking position 4 Map Score: 5.09101 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CAGCTCACTGAACCTAGGAGTAAAGG 1 7 0 AACCTAGGAG 0.867773 -47 CGTAATTTTGAATCGAGGAGTACAGTG 1 37 1 AATCGAGGAG 0.996897 -17 TCTTGTTTAAATCAGAGTAGGAAACGCT 2 15 1 ATCAGAGTAG 0.991114 -18 ********** Masking position 6 Map Score: 3.86952 Number of sites scoring better than the average of aligned sites = 64 Number in coding regions = 56 Number in noncoding regions = 8 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 3 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0