AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00450_tpal_reg_300.orf -o00450_tpal_300.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 TP0794 53 S-adenosylmethionine synthetase (metK) #2 TP0798 32 methionyl-tRNA synthetase (metG) Motif number 1 CACTGAACCTAGGAGTAAAGG 1 2 0 AGGAGTAAAG 0.998838 -52 TTTTGAATCGAGGAGTACAGTG 1 42 1 AGGAGTACAG 0.998617 -12 TTTAAATCAGAGTAGGAAACGCT 2 20 1 AGTAGGAAAC 0.993107 -13 ********** Masking position 4 Map Score: 5.09101 Number of sites scoring better than the average of aligned sites = 13 Number in coding regions = 11 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 2 CCTTTACTCCTAGGTTCAGTGAGCTGCG 1 9 1 CCTAGGTTCA 0.998864 -45 CACTGTACTCCTCGATTCAAAATTACGCA 1 35 0 CCTCGATTCA 0.998881 -19 ********** Masking position 7 Map Score: 2.21081 Number of sites scoring better than the average of aligned sites = 3 Number in coding regions = 1 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 3 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0