AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i00460_tpal_reg_100.orf -o00460_tpal_100.ace -a/home/amcguire/genomes/ORF_tpal.txt -z/home/amcguire/genomes/tpal.fna -g0.53 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.53 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 TP0329 117 serine hydroxymethyltransferase (glyA) #2 TP0556 104 asparagine synthetase (asnA) Motif number 1 TTACGCACGACGGGTATCGGGCATGCGGCG 1 26 1 CGGGTATCGG 0.968067 -92 GGGCATGCGGCGCGCGGCGTTTTGTCCATT 1 44 1 CGCGCGGCGT 0.983059 -74 TTCTCTCCTCAGGTAGGCAGAATATTGTTC 1 94 0 AGGTAGGCAG 0.982559 -24 ATCTGACAGCAGGGAGGTGGT 2 2 0 AGGGAGGTGG 0.994043 -103 ATTATTTAATAGGGTGGCGGTGTAGTGCAA 2 42 0 AGGGTGGCGG 0.99928 -63 ACAAGGTAAAAGGTTGGCGTTAACT 2 90 1 AGGTTGGCGT 0.994278 -15 ********** Masking position 2 Map Score: 9.52096 Number of sites scoring better than the average of aligned sites = 345 Number in coding regions = 286 Number in noncoding regions = 59 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 2 CGTCGTGCGTAACAGGGGAACATACCA 1 6 0 AACAGGAACA 0.986076 -112 TTCTAGCGCAAAGAATGGACAAAACGCCGCGC 1 55 0 AAGAAGACAA 0.990967 -63 GCGCTAGAAACAGAGCGAACAATATTCTGCCT 1 78 1 CAGAGGACAA 0.991099 -40 TGCCTACCTGAGGAGAGAAAAAC 1 105 1 AGGAGGAAAA 0.990399 -13 CAGTTTACTCAACAAGGTAAAAGGTTGGCGTT 2 79 1 AACAAGAAAA 0.98587 -26 ***** * **** Masking position 4 Map Score: 2.82646 Number of sites scoring better than the average of aligned sites = 66 Number in coding regions = 51 Number in noncoding regions = 15 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 3 AAAGAATGGACAAAACGCCGCGCGCCGCATG 1 47 0 CAAAACCCGC 0.995739 -71 ACAGAGCGAACAATATTCTGCCTACCTGAGG 1 87 1 CAATATCTGC 0.985303 -31 ACCACCTCCCTGCTGTCAGATTA 2 3 1 CACCTCCTGC 0.992757 -102 TTGAGTATTGCACTACACCGCCACCCTATTA 2 35 1 CACTACCCGC 0.998433 -70 ****** **** Masking position 2 Map Score: 3.38543 Number of sites scoring better than the average of aligned sites = 91 Number in coding regions = 80 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 4 GCATGCGGCGCGCGGCGTTTTGTCCATTCT 1 46 1 CGCGGCGTTT 0.958547 -72 TTTGTCCATTCTTTGCGCTAGAAACAGAGC 1 64 1 CTTTGCGCTA 0.970311 -54 GCAGAATATTGTTCGCTCTGTTTCTAGCGC 1 78 0 GTTCGCTCTG 0.954348 -40 TATTTAATAGGGTGGCGGTGTAGTGCAATA 2 40 0 GGTGGCGGTG 0.994146 -65 AAGGTAAAAGGTTGGCGTTAACT 2 92 1 GTTGGCGTTA 0.99189 -13 ********** Masking position 9 Map Score: 0.39799 Number of sites scoring better than the average of aligned sites = 433 Number in coding regions = 404 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 26 Fraction of orfs with sites within 600 bp upstream = 0.00417604 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0