AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i039_Mannose_Metabolism_aquae_reg_100.orf -o039_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01343 83 Aquifex_aeolicus #2 RAA01344 45 Aquifex_aeolicus #3 RAA01346 58 Aquifex_aeolicus #4 RAA01406 33 Aquifex_aeolicus Motif number 1 ATGCATTAAAAATAGGAAAAAAGCAA 1 7 0 AATAGGAAAA 0.889586 -77 TATTATTTAAAGTAGGGAGATGTATTACAC 1 40 1 AGTAGGGAGA 0.994695 -44 GTATTACACCTTTTCGGAGACAGCAGGTTT 1 61 1 TTTTCGGAGA 0.737895 -23 AAGATTATGTTGTAGGGAGAATTCTTAAGA 2 13 0 TGTAGGGAGA 0.994348 -33 TACAACATAATCTTGGAAGATGGAGAT 2 29 1 TCTTGGAAGA 0.715927 -17 GTTTAAAATTTATACGGACACTCAATTTAG 3 16 1 TATACGGACA 0.946265 -43 ********** Masking position 3 Map Score: 5.82131 Number of sites scoring better than the average of aligned sites = 323 Number in coding regions = 312 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 9 Fraction of orfs with sites within 600 bp upstream = 0.00144555 Motif number 2 CTCCCTACTTTAAATAATACACATGCATTAAA 1 27 0 TAAATATAAC 0.972959 -57 CGAAAAGGTGTAATACATCTCCCTACTTTAAA 1 45 0 TAATAATCCC 0.964626 -39 GCTCTTAAGAATTCTCCCTACAACATA 2 6 1 TAAGATTCCC 0.955782 -40 AGTGTCCGTATAAATTTTAAACTTACA 3 6 0 TAAATTTAAC 0.950702 -53 AGCATCATATAAAATGATATCCAGT 3 44 1 AAAATATACC 0.98278 -15 TTAGCAGTTTAAAATTATCCCCT 4 2 0 AAAATATCCC 0.98898 -32 ***** *** ** Masking position 8 Map Score: 3.79155 Number of sites scoring better than the average of aligned sites = 154 Number in coding regions = 132 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 3 CCGTATAAATTTTAAACTTACA 3 3 0 TTTAAACTTA 0.953237 -56 TTTATATGATGCTAAATTGAGTGTCCGTAT 3 27 0 GCTAAATTGA 0.961112 -32 TTTAGCATCATATAAAATGATATCCAGT 3 41 1 TATAAAATGA 0.955092 -18 ATTTTAGCAGTTTAAAATTATCCCCT 4 7 0 TTTAAAATTA 0.972029 -27 ATTTTAAACTGCTAAAATTCTAAGT 4 19 1 GCTAAAATTC 0.963152 -15 ********** Masking position 5 Map Score: 2.31807 Number of sites scoring better than the average of aligned sites = 80 Number in coding regions = 56 Number in noncoding regions = 24 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 4 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -7.57276e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0