AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i063_Glycine_Catabolism_aquae_reg_100.orf -o063_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00050 45 Aquifex_aeolicus #2 RAA00054 20 Aquifex_aeolicus #3 RAA00373 162 Aquifex_aeolicus #4 RAA00814 27 Aquifex_aeolicus Motif number 1 CTCTACAAAGAGGTAAAAGCC 1 2 0 AGGTAAAAGC 0.946728 -44 CAGGTGTTTATGGACATAGTAAAGGGGAGT 3 33 0 TGGACATAGT 0.951156 -130 TAAACACCTGAAGGCAAAGTTCACGAACTT 3 53 1 AAGGCAAAGT 0.965035 -110 CTTCGCAGGCTGGACAATGCCACTCCAGTA 3 80 1 TGGACAATGC 0.971147 -83 ACCTCAATAATAGAAGAAGTAAGGGCTGTA 3 111 1 TAGAAGAAGT 0.97345 -52 AAGGGCTGTAAGGGAAGAGCCGGAGTGTTT 3 131 1 AGGGAAGAGC 0.955998 -32 GTGGGAGATGTCAAACACTCC 3 152 0 TGGGAGATGT 0.976452 -11 TAGAAGAAGTATTTTATCTT 4 1 1 TAGAAGAAGT 0.97345 -27 ********** Masking position 3 Map Score: 7.593 Number of sites scoring better than the average of aligned sites = 1148 Number in coding regions = 1090 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 62 Fraction of orfs with sites within 600 bp upstream = 0.00995824 Motif number 2 ACTCTACAAAGAGGTAAAAGCC 1 3 0 GAGGTAAAAG 0.846848 -43 AACTTCTTGGAGGTGGAAGG 2 10 1 GAGGTGGAAG 0.985061 -11 ACATAGTAAAGGGGAGTTTGCATAAAGTAG 3 20 0 GGGGAGTTTG 0.957414 -143 TTTGCCTTCAGGTGTTTATGGACATAGTAA 3 41 0 GGTGTTTATG 0.821137 -122 GAGGTGTACTGGAGTGGCATTGTCCAGCCT 3 86 0 GGAGTGGCAT 0.85853 -77 TTCTATTATTGAGGTGTACTGGAGTGGCAT 3 96 0 GAGGTGTACT 0.945032 -67 GAAGAAGTAAGGGCTGTAAGGGAAGAGCCG 3 123 1 GGGCTGTAAG 0.970796 -40 GGGAAGAGCCGGAGTGTTTGACATCTCCCA 3 142 1 GGAGTGTTTG 0.982378 -21 TAGAAGAAGTATTTTATCTTAATTT 4 6 1 GAAGTATTTT 0.680196 -22 ********** Masking position 1 Map Score: 4.12976 Number of sites scoring better than the average of aligned sites = 1378 Number in coding regions = 1247 Number in noncoding regions = 131 Number of orfs with sites within 600 bp upstream = 106 Fraction of orfs with sites within 600 bp upstream = 0.0170254 Motif number 3 CATAGTAAAGGGGAGTTTGCATAAAGTAGA 3 19 0 GGGAGTTTGC 0.987274 -144 GCGAAGTTCGTGAACTTTGCCTTCAGGTGT 3 56 0 TGAACTTTGC 0.994187 -107 GCAAAGTTCACGAACTTCGCAGGCTGGACA 3 66 1 CGAACTTCGC 0.988314 -97 CTTCGCAGGCTGGACAATGCCACTCCAGTA 3 80 1 TGGACAATGC 0.976731 -83 ********** Masking position 4 Map Score: 1.76746 Number of sites scoring better than the average of aligned sites = 54 Number in coding regions = 50 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 4 ********** No masking Map Score: 2.58227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.58227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.58227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0