AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i076_Lipopolysaccharide_Biosynthesis_1_aquae_reg_300.orf -o076_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00033 89 Aquifex_aeolicus #2 RAA00044 263 Aquifex_aeolicus Motif number 1 AACTTCTTTTTTCTCCTCTTCATCGGAT 1 9 1 TTTTCTCCTC 0.948278 -81 GCTAACTAGATCTTCCTTTACCTCTATAAG 1 47 1 TCTTCCTTTA 0.968498 -43 GATTTTCTATTGTATACTCAAT 1 78 0 TTTTCTATTG 0.900426 -12 AAGCTATAATTTTTCAATTATGGGCAAGCT 2 25 1 TTTTCAATTA 0.893604 -239 CAGCAAATAAAATTCCCTTATTAAGGGATA 2 111 1 AATTCCCTTA 0.813778 -153 TTCTTTTAATTTATCCCTTAATAAGGGAAT 2 122 0 TTATCCCTTA 0.942086 -142 TATAAACACGTATTCTTTTAATTTATCCCT 2 134 0 TATTCTTTTA 0.946971 -130 AGCTTTTTTCTTTTCCTTTCCAAGTTTTTA 2 171 0 TTTTCCTTTC 0.974784 -93 AGAAAAAAGCTTTTCCATTAAGAATCTTGA 2 190 1 TTTTCCATTA 0.98191 -74 GTAGATTATTTCTTCTTCTAAATCAAGATT 2 224 0 TCTTCTTCTA 0.923518 -40 GAAGAAGAAATAATCTACTCAAAGCTTAAG 2 236 1 TAATCTACTC 0.663975 -28 ********** Masking position 4 Map Score: 10.8756 Number of sites scoring better than the average of aligned sites = 1835 Number in coding regions = 1692 Number in noncoding regions = 143 Number of orfs with sites within 600 bp upstream = 130 Fraction of orfs with sites within 600 bp upstream = 0.0208802 Motif number 2 CATCGGATATAATTAAGCTAACTAGATCTT 1 31 1 AATTAAGCTA 0.981111 -59 AATTAGGTTATTTTAAGCTATAATTTTTCA 2 11 1 TTTTAAGCTA 0.907767 -253 CTTTTTGGTTTATAATGCTAAATTTTCAAG 2 58 1 TATAATGCTA 0.88282 -206 TAATTACCCTAAATATGCTTGAAAATTTAG 2 75 0 AAATATGCTT 0.930154 -189 AAAGGAAAAGAAAAAAGCTTTTCCATTAAG 2 182 1 AAAAAAGCTT 0.930199 -82 TTAGAAGAAGAAATAATCTACTCAAAGCTT 2 233 1 AAATAATCTA 0.838036 -31 TTTATGTTCTTAAGCTTTGAGTAGATT 2 247 0 TCTTAAGCTT 0.918051 -17 ********** Masking position 5 Map Score: 4.43997 Number of sites scoring better than the average of aligned sites = 189 Number in coding regions = 167 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 30 Fraction of orfs with sites within 600 bp upstream = 0.0048185 Motif number 3 TAGTTAGCTTAATTATATCCGATGAAGAGG 1 25 0 AATTATATCC 0.968941 -65 ATAATTGAAAAATTATAGCTTAAAATAACC 2 16 0 AATTATAGCT 0.943441 -248 ATATGCTTGAAAATTTAGCATTATAAACCA 2 63 0 AAATTTAGCA 0.937004 -201 TATTTAGGGTAATTATAACAACAGCAAATA 2 90 1 AATTATAACA 0.894725 -174 TTAATAAGGGAATTTTATTTGCTGTTGTTA 2 105 0 AATTTTATTT 0.694739 -159 CGTATTCTTTTAATTTATCCCTTAATAAGG 2 126 0 TAATTTATCC 0.8008 -138 AGTTTTTACTAAATATATAAACACGTATTC 2 149 0 AAATATATAA 0.766928 -115 ********** Masking position 7 Map Score: 0.924988 Number of sites scoring better than the average of aligned sites = 188 Number in coding regions = 138 Number in noncoding regions = 50 Number of orfs with sites within 600 bp upstream = 65 Fraction of orfs with sites within 600 bp upstream = 0.0104401 Motif number 4 GTATACTCAATTCTTATAGAGGTAAAGGAA 1 59 0 TTCTTATAGA 0.854344 -31 AATTAGGTTATTTTAAGCTATAATTTT 2 8 1 TTATTTTAAG 0.788818 -256 GGGCAAGCTGTTCTTTTTGGTTTATAATGC 2 46 1 TTCTTTTTGG 0.974332 -218 ATTTTCAAGCATATTTAGGGTAATTATAAC 2 79 1 ATATTTAGGG 0.90207 -185 TAAAATTCCCTTATTAAGGGATAAATTAAA 2 118 1 TTATTAAGGG 0.971399 -146 ACCTTCAAGATTCTTAATGGAAAAGCTTTT 2 194 0 TTCTTAATGG 0.971853 -70 ********** Masking position 5 Map Score: 1.28807 Number of sites scoring better than the average of aligned sites = 572 Number in coding regions = 533 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 43 Fraction of orfs with sites within 600 bp upstream = 0.00690652 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0