AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i217_Ribosomal_Operon_4_aquae_reg_100.orf -o217_aquae_100.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01773 43 Aquifex_aeolicus #2 RAA00886 18 Aquifex_aeolicus #3 RAA00888 49 Aquifex_aeolicus Motif number 1 ATTTAAAGGAGAGAGAAGGGC 1 2 0 GAGAGAAGGG 0.994399 -42 TTTTATTTAGGAGGATATTGGA 1 32 1 GAGGATATTG 0.983461 -12 GCTTTAAGGAGGTAGGTG 2 9 1 GAGGTAGGTG 0.997092 -10 ATAATTTTCTGAGCCAATTGCAAAAGAGGT 3 23 1 GAGCCAATTG 0.990836 -27 AATTGCAAAAGAGGTAAGGGAA 3 38 1 GAGGTAAGGG 0.998809 -12 ********** Masking position 2 Map Score: 8.60748 Number of sites scoring better than the average of aligned sites = 371 Number in coding regions = 342 Number in noncoding regions = 29 Number of orfs with sites within 600 bp upstream = 27 Fraction of orfs with sites within 600 bp upstream = 0.00433665 Motif number 2 CTCTCTCCTTTAAATTTTTATTTAGGAGGA 1 17 1 TAAATTTTTA 0.768905 -27 CAAATTTATGTTATAATTTT 3 1 1 CAAATTTATG 0.921351 -49 ATTTATGTTATAATTTTCTGAGCCAATTGC 3 14 1 TAATTTTCTG 0.987171 -36 ********** Masking position 3 Map Score: 0.872747 Number of sites scoring better than the average of aligned sites = 61 Number in coding regions = 42 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.44113e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0