AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i297_mixed12_aquae_reg_300.orf -o297_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00952 300 Aquifex_aeolicus Motif number 1 GCCGAAGGAGGCAAAGTTATGCGACATGTA 1 12 0 GCAAAGTTAT 0.911001 -289 GCCTCCTTCGGCAAAATAAAAGTATAATAC 1 30 1 GCAAAATAAA 0.92348 -271 CAACAATTGTGAAAAAAAAAGTTTAAATTA 1 59 1 GAAAAAAAAA 0.798197 -242 AAAGAGATCAACAAAAGTAAGACCGCTTAT 1 144 0 ACAAAAGTAA 0.884364 -157 TCCCGTTCCCGCAAAGAGATCAACAAAAGT 1 156 0 GCAAAGAGAT 0.924011 -145 AAAGGAGGGTGCAAAGGTCATTTTCGTAGA 1 205 1 GCAAAGGTCA 0.989702 -96 CATTTTCGTAGAAAAGAACAGGAAACTTGC 1 223 1 GAAAAGAACA 0.895755 -78 CAGGAAACTTGCAAACGAAATAAAGAAGAA 1 241 1 GCAAACGAAA 0.962895 -60 GAAAACTAAGGGAAAGGTAATTGTCGGGGA 1 268 1 GGAAAGGTAA 0.97949 -33 AAAAGAAAGGGCATCCCCGACAA 1 288 0 AGAAAGGGCA 0.829736 -13 ********** Masking position 5 Map Score: 8.6762 Number of sites scoring better than the average of aligned sites = 2229 Number in coding regions = 2118 Number in noncoding regions = 111 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 2 TCGCATAACTTTGCCTCCTTCGGCAAAATAA 1 18 1 TTGCCCCTTC 0.99563 -283 CAGTCCAATCTGTCCCGTTCCCGCAAAGAGA 1 167 0 TGTCCGTTCC 0.969012 -134 TGCACCCTCCTTTCCGCCTCCAGTCCAATCT 1 187 0 TTTCCCCTCC 0.99563 -114 AAAATGACCTTTGCACCCTCCTTTCCGCCTC 1 198 0 TTGCACCTCC 0.99563 -103 TTTATTTCGTTTGCAAGTTTCCTGTTCTTTT 1 234 0 TTGCAGTTTC 0.968564 -67 ***** ***** Masking position 9 Map Score: 4.46797 Number of sites scoring better than the average of aligned sites = 208 Number in coding regions = 180 Number in noncoding regions = 28 Number of orfs with sites within 600 bp upstream = 34 Fraction of orfs with sites within 600 bp upstream = 0.00546097 Motif number 3 CATCTTTAACATACTCGGAGACATAAGCGGT 1 122 1 ATATCGGAGA 0.994139 -179 TGCAAAGGTCATTTTCGTAGAAAAGAACAGG 1 214 1 ATTTCGTAGA 0.990963 -87 GGGAAAGGTAATTGTCGGGGATGCCCTTTCT 1 277 1 ATTTCGGGGA 0.996038 -24 *** ******* Masking position 1 Map Score: 0.629145 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 25 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 4 AACTTTGCCTCCTTCGGCAAAATAAAAGTA 1 24 1 CCTTCGGCAA 0.98656 -277 CCGACGAAATCCATCGTTAAAAACGCCATC 1 96 1 CCATCGTTAA 0.994501 -205 GTTAAAAACGCCATCTTTAACATACTCGGA 1 111 1 CCATCTTTAA 0.985329 -190 ********** Masking position 9 Map Score: 0.807304 Number of sites scoring better than the average of aligned sites = 11 Number in coding regions = 10 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0