AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i298_mixed13_aquae_reg_300.orf -o298_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA00894 176 Aquifex_aeolicus #2 RAA00898 53 Aquifex_aeolicus #3 RAA01548 29 Aquifex_aeolicus Motif number 1 TCTTCTCAAATTCTTCTACGGAAACGAATA 1 17 0 TTCTTCTACG 0.997492 -160 GCCTTCCTTTATCTTCTTCTCAAATTCTTC 1 31 0 ATCTTCTTCT 0.962374 -146 AAAGGAAGGCTTCTTCCTCGAGTACGCGAA 1 51 1 TTCTTCCTCG 0.987825 -126 TTCCTCTATGTCCTTCTTCGGCGTCCCATA 1 97 0 TCCTTCTTCG 0.987825 -80 CGTTTATGGTTTCCTCTATGTCCTTCTTCG 1 107 0 TTCCTCTATG 0.98891 -70 GCGCGTCCTTTTTCTCTACGTTTATGGTTT 1 125 0 TTTCTCTACG 0.977547 -52 TATTTTCCTTATCCTCTCCG 3 1 0 ATCCTCTCCG 0.984685 -29 GATTTCTTCTATTTTCCTTATCC 3 17 0 TTCTTCTATT 0.954146 -13 ********** Masking position 5 Map Score: 16.3124 Number of sites scoring better than the average of aligned sites = 815 Number in coding regions = 767 Number in noncoding regions = 48 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 2 TCTTCTACGGAAACGAATACGTAGT 1 4 0 AAACGAACGT 0.977415 -173 AGAAGAAGATAAAGGAAGGCTTCTTCCTCGAG 1 41 1 AAAGGAGCTT 0.994785 -136 TAATTTCCGTAAACGTTCGCGTACTCGAGGAA 1 64 0 AAACGTGCGT 0.971499 -113 AGAAGGACATAGAGGAAACCATAAACGTAGAG 1 110 1 AGAGGACCAT 0.930157 -67 AACGTAGAGAAAAAGGACGCGCTCCTTATCAT 1 133 1 AAAAGAGCGC 0.981615 -44 TTTAAAGGCACCCTGGACGTCTATG 1 162 0 AAAGGACCTG 0.975355 -15 ATAGCCTTTAAAAAGTAAGCTTGTAGAAATAT 2 22 1 AAAAGAGCTT 0.989156 -32 ***** * **** Masking position 3 Map Score: 6.19045 Number of sites scoring better than the average of aligned sites = 365 Number in coding regions = 347 Number in noncoding regions = 18 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 3 TACTCGAGGAAGAAGCCTTCCTTTATCTTCT 1 44 0 AGAAGCCTCC 0.759311 -133 TCTTCCTCGAGTACGCGAACGTTTACGGAAA 1 62 1 GTACGCGACG 0.991382 -115 AATTACTATGGGACGCCGAAGAAGGACATAG 1 91 1 GGACGCCAAG 0.986053 -86 TAGAGAAAAAGGACGCGCTCCTTATCATAGA 1 137 1 GGACGCGTCC 0.966914 -40 AAGGCACCCTGGACGTCTATGATAAGGAGCG 1 152 0 GGACGTCATG 0.976466 -25 ******* *** Masking position 3 Map Score: 2.05354 Number of sites scoring better than the average of aligned sites = 187 Number in coding regions = 174 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 6 Fraction of orfs with sites within 600 bp upstream = 0.000963701 Motif number 4 AAATTCTTCTACGGAAACGAATACGTAGT 1 10 0 ACGGAAACGA 0.984532 -167 GCGAACGTTTACGGAAATTACTATGGGACG 1 76 1 ACGGAAATTA 0.990248 -101 GGCACCCTGGACGTCTATGATAAGGAGCGC 1 151 0 ACGTCTATGA 0.940443 -26 TTACTTTTTAAAGGCTATTATAAAAGTGT 2 10 0 AAGGCTATTA 0.971394 -44 CGGAGAGGATAAGGAAAATAGAAGAAATC 3 11 1 AAGGAAAATA 0.946922 -19 ********** Masking position 7 Map Score: 3.01394 Number of sites scoring better than the average of aligned sites = 304 Number in coding regions = 288 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 19 Fraction of orfs with sites within 600 bp upstream = 0.00305172 Motif number 5 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.95472e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0