AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i334_1_aquae_reg_300.orf -o334_aquae_300.ace -a/home/amcguire/genomes/ORF_aquae.txt -z/home/amcguire/genomes/aquae.fna -g0.44 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.44 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAA01050 20 Aquifex_aeolicus #2 RAA01696 145 Aquifex_aeolicus #3 RAA01698 50 Aquifex_aeolicus Motif number 1 CTCCACCCCCACCACCCAACC 2 2 0 ACCACCCAAC 0.875452 -144 GAGGGTTCGACTCCCTCCACCCCCACCACC 2 16 0 CTCCCTCCAC 0.930607 -130 CTGGGCGAAAAGCCCGTGAGGGTTCGACTC 2 33 0 AGCCCGTGAG 0.954687 -113 GGGACTTAAAATCCCCTGGGCGAAAAGCCC 2 48 0 ATCCCCTGGG 0.978165 -98 GGGGATTTTAAGTCCCCCGCGTCTGCCAAT 2 62 1 AGTCCCCCGC 0.98923 -84 GCGTCTGCCAATTCCGCCACACCCCCTAAC 2 80 1 ATTCCGCCAC 0.967346 -66 ATTCCGCCACACCCCCTAACTAAAGAAATA 2 90 1 ACCCCCTAAC 0.980399 -56 GATTTCTTGAGAAAAGTTCTT 2 135 0 ATTTCTTGAG 0.693607 -11 TTATTATAAAAGTTCTTCGCTT 3 3 0 AGTTCTTCGC 0.915692 -48 TTACCTACCTCCTCGCAAGATAAAAA 3 35 0 ACCTCCTCGC 0.984874 -16 ********** Masking position 5 Map Score: 8.02389 Number of sites scoring better than the average of aligned sites = 1770 Number in coding regions = 1597 Number in noncoding regions = 173 Number of orfs with sites within 600 bp upstream = 104 Fraction of orfs with sites within 600 bp upstream = 0.0167041 Motif number 2 GATTTCTTGAGAAAAGTTCTTTCTATAA 2 128 0 GAGAAAAGTT 0.991593 -18 AAAAAGTTATTATAAAAGTTCTTCGCTT 3 9 0 TATAAAAGTT 0.989549 -42 CCTCGCAAGATAAAAAAGTTATTATAAAAG 3 21 0 TAAAAAAGTT 0.989549 -30 ********** Masking position 5 Map Score: 2.69003 Number of sites scoring better than the average of aligned sites = 33 Number in coding regions = 30 Number in noncoding regions = 3 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0