AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_aful_reg_100.orf -o107_aful_100.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG02435 213 Archaeoglobus_fulgidus #2 RAG46312 63 Archaeoglobus_fulgidus #3 RAG46188 27 Archaeoglobus_fulgidus Motif number 1 ATTCGAGGTAACTTAAACCTTACTCGGTTT 1 35 1 ACTTAAACCT 0.952914 -179 TCCCTACAACGGAAAAACCGAGTAAGGTTT 1 49 0 GGAAAAACCG 0.982093 -165 CTATTTTCGAACAAAAAACTTATATTTACG 1 90 0 ACAAAAAACT 0.877627 -124 CGAAAATAGAACTAAAACCTCTCAAGTGAT 1 111 1 ACTAAAACCT 0.982235 -103 TCAAAAGAATAGAAAAGCCGTGATGTGGGG 1 155 0 AGAAAAGCCG 0.975514 -59 TCTATTCTTTTGATAAACCAGAATTGCCAA 1 172 1 TGATAAACCA 0.820694 -42 TAGCGTCTCAAGTAAAAGCGGTCGTTGAAC 2 12 0 AGTAAAAGCG 0.966482 -52 CTAACACTTTTATAAAACCGCAATCCAGAA 2 39 1 TATAAAACCG 0.925946 -25 ********** Masking position 5 Map Score: 6.08791 Number of sites scoring better than the average of aligned sites = 543 Number in coding regions = 480 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 AATATGAATGAATGAGGTGGTGAG 1 4 0 AATGAGGGGT 0.917607 -210 TTTTCTATCACTTGAGAGGTTTTAGTTCTAT 1 116 0 CTTGAGAGTT 0.971523 -98 CTCTCAAGTGATAGAAAAGGTCAGAGCCCCA 1 129 1 ATAGAAAGGT 0.982255 -85 TATCAAAAGAATAGAAAAGCCGTGATGTGGG 1 156 0 ATAGAAAGCC 0.909855 -58 ACCGCTTTTACTTGAGACGCTAACACTTTTA 2 20 1 CTTGAGAGCT 0.973564 -44 TTGCGGTTTTATAAAAGTGTTAGCGTCTCAA 2 31 0 ATAAAAGGTT 0.793946 -33 AAACCGCAATCCAGAAGTGGT 2 53 1 CCAGAAGGGT 0.942408 -11 ATAGAGAAGTTTGGGGAGAAA 3 1 1 ATAGAGAGTT 0.982406 -27 ******* *** Masking position 5 Map Score: 4.94279 Number of sites scoring better than the average of aligned sites = 1045 Number in coding regions = 971 Number in noncoding regions = 74 Number of orfs with sites within 600 bp upstream = 54 Fraction of orfs with sites within 600 bp upstream = 0.00867331 Motif number 3 TATTTACGAGAGCATTCTTTCCCTACAACG 1 68 0 AGCATTCTTT 0.992337 -146 GCTGAAGCATTCTTCGTATTGTTTG 1 199 0 AGCATTCTTC 0.990921 -15 CTCAAGTAAAAGCGGTCGTTGAACA 2 6 0 AGCGGTCGTT 0.98093 -58 ********** Masking position 1 Map Score: 0.577447 Number of sites scoring better than the average of aligned sites = 34 Number in coding regions = 33 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0