AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_aful_reg_300.orf -o107_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG02435 213 Archaeoglobus_fulgidus #2 RAG46312 63 Archaeoglobus_fulgidus #3 RAG46188 27 Archaeoglobus_fulgidus Motif number 1 AAACCGAGTAAGGTTTAAGTTACCTCGAAT 1 35 0 AGGTTTAAGT 0.952369 -179 AAACCTTACTCGGTTTTTCCGTTGTAGGGA 1 49 1 CGGTTTTTCC 0.981879 -165 CGTAAATATAAGTTTTTTGTTCGAAAATAG 1 90 1 AGTTTTTTGT 0.876323 -124 ATCACTTGAGAGGTTTTAGTTCTATTTTCG 1 111 0 AGGTTTTAGT 0.982023 -103 CCCCACATCACGGCTTTTCTATTCTTTTGA 1 155 1 CGGCTTTTCT 0.975223 -59 TTGGCAATTCTGGTTTATCAAAAGAATAGA 1 172 0 TGGTTTATCA 0.818909 -42 GTTCAACGACCGCTTTTACTTGAGACGCTA 2 12 1 CGCTTTTACT 0.966088 -52 TTCTGGATTGCGGTTTTATAAAAGTGTTAG 2 39 0 CGGTTTTATA 0.925113 -25 ********** Masking position 5 Map Score: 6.08791 Number of sites scoring better than the average of aligned sites = 543 Number in coding regions = 480 Number in noncoding regions = 63 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 TACGAGAGCATTCTTTCCCTACAACGGAAA 1 64 0 TTCTTTCCCT 0.988302 -150 GAGGTTTTAGTTCTATTTTCGAACAAAAAA 1 102 0 TTCTATTTTC 0.943316 -112 CTCTGACCTTTTCTATCACTTGAGAGGTTT 1 125 0 TTCTATCACT 0.977965 -89 ATCACGGCTTTTCTATTCTTTTGATAAACC 1 161 1 TTCTATTCTT 0.959751 -53 ATCTTCTTTCTCCCCAAACTTCT 3 15 0 TTCTTTCTCC 0.983322 -13 ********** Masking position 6 Map Score: 3.70488 Number of sites scoring better than the average of aligned sites = 273 Number in coding regions = 253 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 AGAACTAAAACCTCTCAAGTGATAGAAAAG 1 118 1 CCTCTCAAGT 0.996567 -96 AAAGTGTTAGCGTCTCAAGTAAAAGCGGTC 2 19 0 CGTCTCAAGT 0.997062 -45 ********** Masking position 5 Map Score: 0.617159 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 GTTGTAGGGAAAGAATGCTCTCGTAAATAT 1 69 1 AAGAATGCTC 0.930773 -145 AAACAATACGAAGAATGCTTCAGC 1 200 1 AAGAATGCTT 0.696917 -14 TGTTCAACGACCGCTTTTACTTGAGA 2 7 1 ACGACCGCTT 0.986245 -57 ********** Masking position 4 Map Score: 0.577447 Number of sites scoring better than the average of aligned sites = 35 Number in coding regions = 33 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 5 TATGAATGAATGAGGTGGTGAG 1 3 0 TGAGGTGGTG 0.990573 -211 TCGGTTTTTCCGTTGTAGGGAAAGAATGCT 1 58 1 CGTTGTAGGG 0.983473 -156 AGAAAAGCCGTGATGTGGGGCTCTGACCTT 1 145 0 TGATGTGGGG 0.997076 -69 ********** Masking position 6 Map Score: 0.185642 Number of sites scoring better than the average of aligned sites = 98 Number in coding regions = 92 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -2.17836e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0