AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i228_6_1_1_17_aful_reg_300.orf -o228_aful_300.ace -a/home/amcguire/alignace/lib/ORF_aful.txt -z/skink1/amcguire/genomes/aful.fna -g0.49 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.49 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RAG50068 112 Archaeoglobus_fulgidus Motif number 1 AACCTCAACTTCAAGCAAAATCCA 1 5 0 TCAAGCAAAA 0.987625 -108 CTAAAAAATTTTAACCTCAACTTCAAGCAA 1 17 0 TTAACCTCAA 0.970986 -96 AGCGCATCACCCAACCTAAAAAATTTTAAC 1 32 0 CCAACCTAAA 0.997204 -81 TTTTATCGGCCCAACCAGAACAACATCA 1 95 1 CCAACCAGAA 0.996731 -18 ********** Masking position 4 Map Score: 5.01796 Number of sites scoring better than the average of aligned sites = 243 Number in coding regions = 213 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 2 TGTCTTGAAGTATTTAGCGCATCACCCAAC 1 47 0 TATTTAGCGC 0.994262 -66 CAAGACAGGCCTTTTAGCGGTAAATTTTTA 1 70 1 CTTTTAGCGG 0.997719 -43 TAGCGGTAAATTTTTATCGGCCCAACCAGA 1 84 1 TTTTTATCGG 0.99516 -29 ********** Masking position 6 Map Score: 3.65423 Number of sites scoring better than the average of aligned sites = 9 Number in coding regions = 7 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 4 Fraction of orfs with sites within 600 bp upstream = 0.000642467 Motif number 3 AAATTTTAACCTCAACTTCAAGCAAAATCC 1 12 0 CTCAACTTCA 0.982496 -101 ACCCAACCTAAAAAATTTTAACCTCAACTT 1 24 0 AAAAATTTTA 0.85515 -89 GTGATGCGCTAAATACTTCAAGACAGGCCT 1 52 1 AAATACTTCA 0.983924 -61 GCCCAACCAGAACAACATCA 1 103 1 AACAACATCA 0.989649 -10 ********** Masking position 5 Map Score: 1.57505 Number of sites scoring better than the average of aligned sites = 713 Number in coding regions = 656 Number in noncoding regions = 57 Number of orfs with sites within 600 bp upstream = 50 Fraction of orfs with sites within 600 bp upstream = 0.00803084 Motif number 4 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 1.3033e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0