AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i100_Ion_Transporter_bbur_reg_300.orf -o100_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00043 87 3615 Motif number 1 ATTATCATAATTACATTATTTTTAATAT 1 9 0 TTACATTATT 0.993222 -79 TATTTTAACATTGAAATATTATCATAATTA 1 26 0 TTGAAATATT 0.990346 -62 TATTTCAATGTTAAAATATTATGCTATATA 1 38 1 TTAAAATATT 0.995605 -50 GCTATATAAGATAAATTTTTAATAATTTAA 1 60 1 ATAAATTTTT 0.88561 -28 AAAGTTGTTTAAATTATTAAAAATTTAT 1 70 0 TTAAATTATT 0.996516 -18 ********** Masking position 5 Map Score: 11.9754 Number of sites scoring better than the average of aligned sites = 264 Number in coding regions = 162 Number in noncoding regions = 102 Number of orfs with sites within 600 bp upstream = 33 Fraction of orfs with sites within 600 bp upstream = 0.00530035 Motif number 2 ATATTAAAAATAATGTAATT 1 1 1 ATATTAAAAA 0.894151 -87 CATTGAAATATTATCATAATTACATTATTT 1 18 0 TTATCATAAT 0.974458 -70 TAATATTTCAATGTTAAAATATTATGCTAT 1 35 1 ATGTTAAAAT 0.820097 -53 TTTATCTTATATAGCATAATATTTTAACAT 1 45 0 ATAGCATAAT 0.973162 -43 ATTATGCTATATAAGATAAATTTTTAATAA 1 55 1 ATAAGATAAA 0.929169 -33 GTTGTTTAAATTATTAAAAATTTATCTTAT 1 65 0 TTATTAAAAA 0.884233 -23 ********** Masking position 6 Map Score: 7.38464 Number of sites scoring better than the average of aligned sites = 1413 Number in coding regions = 893 Number in noncoding regions = 520 Number of orfs with sites within 600 bp upstream = 112 Fraction of orfs with sites within 600 bp upstream = 0.0179891 Motif number 3 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 5.21701e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0