AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i118_SecDF_bbur_reg_100.orf -o118_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00112 194 3615 #2 RBB00111 23 3615 #3 RBB00109 85 3615 Motif number 1 TCTTTAAATTATAAAGACAAAGAATTT 1 2 0 ATAAAAAATT 0.99215 -193 AATTTTTATTATATAATGTAAATATTGACTAATCTT 1 34 0 ATATAAAATT 0.936058 -161 CAAAATATACAAAACCAGTAAAAATTTTTATTATAT 1 56 0 AAAACAAATT 0.981149 -139 CTATGCATCAAAAAATACAAAATATACAAAACCAGT 1 73 0 AAAAAAAATA 0.945499 -122 TAAGATTAACATAAACTTAATACATTCGCTATAGTA 1 120 0 ATAAAATATT 0.936067 -75 TAATTTACATATAACAATATAAGATTAACATAAACT 1 139 0 ATAACTAATT 0.945799 -56 ACCCCTTTCTATAAATAAAAATAATTTACATATAAC 1 160 0 ATAAAAAATT 0.99202 -35 TTTTATTTATAGAAAGGGGTAAAATTTTT 1 176 1 AGAAATAATT 0.948481 -19 AGTTAAAAAAAAGGTATTGTTTAAAGGTAAA 3 6 1 AAAAATAGTT 0.949041 -80 TGTTTAAAGGTAAAATTAGAACTGTTAGCTAATAAT 3 28 1 TAAAAAAGTT 0.857412 -58 TAAAATTTTTAAAAAATACCATTATTAGCTAACAGT 3 48 0 AAAAACAATT 0.959821 -38 GGTATTTTTTAAAAATTTTAAGGATTTGTATA 3 64 1 AAAAAAAATT 0.992316 -22 ***** ** *** Masking position 3 Map Score: 18.2246 Number of sites scoring better than the average of aligned sites = 1191 Number in coding regions = 762 Number in noncoding regions = 429 Number of orfs with sites within 600 bp upstream = 101 Fraction of orfs with sites within 600 bp upstream = 0.0162223 Motif number 2 GTCTTTATAATTTAAAGATTAGTCAATATT 1 20 1 TTTAAAGATT 0.94047 -175 TATTATATAATGTAAATATTGACTAATCTT 1 34 0 TGTAAATATT 0.971658 -161 ATACAAAACCAGTAAAAATTTTTATTATAT 1 56 0 AGTAAAAATT 0.942353 -139 TTACTGGTTTTGTATATTTTGTATTTTTTG 1 71 1 TGTATATTTT 0.828334 -124 TATTGTTATATGTAAATTATTTTTATTTAT 1 156 1 TGTAAATTAT 0.905057 -39 TATAGAAAGGGGTAAAATTTTT 1 183 1 GGTAAAATTT 0.961958 -12 ATTAAAGTTTCACCGGCAAG 2 1 1 ATTAAAGTTT 0.852587 -23 TAATTTTACCTTTAAACAATACCTTTTTTT 3 16 0 TTTAAACAAT 0.704679 -70 ATTGTTTAAAGGTAAAATTAGAACTGTTAG 3 26 1 GGTAAAATTA 0.780609 -60 AATGGTATTTTTTAAAAATTTTAAGGATTT 3 61 1 TTTAAAAATT 0.95014 -25 ********** Masking position 6 Map Score: 9.7292 Number of sites scoring better than the average of aligned sites = 1788 Number in coding regions = 1193 Number in noncoding regions = 595 Number of orfs with sites within 600 bp upstream = 118 Fraction of orfs with sites within 600 bp upstream = 0.0189528 Motif number 3 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.53363e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0