AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i150_ATP_synthase_1_bbur_reg_100.orf -o150_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00641 21 3615 #2 RBB00640 85 3615 #3 RBB00638 183 3615 Motif number 1 GGGGTTTGGAGAAATATATAT 1 10 1 AGAAATATAT 0.932302 -12 AAAAGGAATTTAAATGAATA 2 1 1 AAAAGGAATT 0.829427 -85 AAATGAATACAAAAGGAAAAGTCGTTGGAG 2 22 1 AAAAGGAAAA 0.902358 -64 CTCAACTATTAGAAATAATACAACCA 3 7 0 AGAAATAATA 0.87932 -177 ATAGTTGAGAATAAGTATATTCTTTAAAGA 3 28 1 ATAAGTATAT 0.815033 -156 TATTCTTTAAAGAAGTATTATTGTGCCAAC 3 45 1 AGAAGTATTA 0.949544 -139 TACAATATTAAAAAACATATCAAGTTGGCA 3 68 0 AAAAACATAT 0.879802 -116 TTTTAATATCAAAAATTTTACAATATTAAA 3 86 0 AAAAATTTTA 0.78963 -98 TTTTGATATTAAAAATTTATTTTATGCTTT 3 102 1 AAAAATTTAT 0.612658 -82 AAAACTTTAAAAAAGCATAAAATAAATTTT 3 113 0 AAAAGCATAA 0.946545 -71 ATTAGCAAACAAAACTTTAAAAAAGCATAA 3 123 0 AAAACTTTAA 0.764134 -61 CATATAAGATAAAAATAATAACCTAACACT 3 154 0 AAAAATAATA 0.920764 -30 ********** Masking position 4 Map Score: 11.3298 Number of sites scoring better than the average of aligned sites = 3967 Number in coding regions = 2578 Number in noncoding regions = 1389 Number of orfs with sites within 600 bp upstream = 221 Fraction of orfs with sites within 600 bp upstream = 0.0354963 Motif number 2 AGTAACTAAGTTTCCATTAACTCCAACGAC 2 42 0 TTTCCATTAA 0.943454 -44 GGTTGTATTATTTCTAATAGTTGAGAATAA 3 12 1 TTTCTAATAG 0.918081 -172 TTTCTAATAGTTGAGAATAAGTATATTCTT 3 22 1 TTGAGAATAA 0.900073 -162 TATCAAAAATTTTACAATATTAAAAAACAT 3 80 0 TTTACAATAT 0.929163 -104 TGTAAAATTTTTGATATTAAAAATTTATTT 3 94 1 TTGATATTAA 0.913602 -90 ATATTAAAAATTTATTTTATGCTTTTTTAA 3 107 1 TTTATTTTAT 0.801773 -77 AAAGTTTTGTTTGCTAATAAGTGTTAGGTT 3 135 1 TTGCTAATAA 0.960388 -49 GGTTATTATTTTTATCTTATATGATAAGGA 3 161 1 TTTATCTTAT 0.856465 -23 ********** Masking position 9 Map Score: 4.77344 Number of sites scoring better than the average of aligned sites = 1131 Number in coding regions = 723 Number in noncoding regions = 408 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 3 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.17312e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0