AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i216_Ribosomal_Operon_3_bbur_reg_100.orf -o216_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Purged sequences: RBB00067 53 3615 Input sequences: #1 RBB00683 79 3615 #2 RBB00068 158 3615 Motif number 1 CAGTAATTGGTTTTTAATTTTAA 1 3 0 TTTTTATTTT 0.983362 -77 AATATTTTTATTTATTATAATATGAAATTGT 1 42 0 TTTATATAAT 0.933968 -38 TTGACCTTTTTTTAAAATATTTTTATTTATT 1 57 0 TTTAAATATT 0.977947 -23 GTTTTTGATATTTTATGAATGT 2 2 1 TTTTTATATT 0.993808 -157 CTAAAAAACATTTTACATCATAATATCACAT 2 29 0 TTTTAATCAT 0.891718 -130 CAATACAATATTTTATCTATTCTTAAAAGAC 2 78 0 TTTTACTATT 0.951896 -81 TGTATTGGTTTTTTTGATATGATATTTTATA 2 102 1 TTTTTATATG 0.97414 -57 GATATGATATTTTATAATATTTTTTTTATTT 2 117 1 TTTATATATT 0.987239 -42 TTATAATATTTTTTTTATTTTAAAAATAAAG 2 128 1 TTTTTATTTT 0.983362 -31 ***** ***** Masking position 8 Map Score: 17.2026 Number of sites scoring better than the average of aligned sites = 1224 Number in coding regions = 793 Number in noncoding regions = 431 Number of orfs with sites within 600 bp upstream = 90 Fraction of orfs with sites within 600 bp upstream = 0.0144555 Motif number 2 TTATCAGTAATTGGTTTTTAATTTTAA 1 8 0 TTGGTTTTTA 0.98204 -72 TTTTAAAATATTTTTATTTATTATAATATG 1 49 0 TTTTTATTTA 0.907079 -31 AATTGACCTTTTTTTAAAATAT 1 68 0 TTGACCTTTT 0.856329 -12 GTTTTTGATATTTTATGAATGTGA 2 5 1 TTGATATTTT 0.959391 -154 ATGATGTAAAATGTTTTTTAGCCTTATAAA 2 39 1 ATGTTTTTTA 0.9676 -120 AAAGGCATGTTTGTCTTTTAAGAATAGATA 2 66 1 TTGTCTTTTA 0.965939 -93 AAATATTGTATTGGTTTTTTTGATATGATA 2 96 1 TTGGTTTTTT 0.973923 -63 TTTTTTTGATATGATATTTTATAATATTTT 2 110 1 ATGATATTTT 0.914526 -49 ATTTTATAATATTTTTTTTATTTTAAAAAT 2 125 1 ATTTTTTTTA 0.893916 -34 ATACACCTCCTTTATTTTTAAAATAAAAAA 2 138 0 TTTATTTTTA 0.949004 -21 ********** Masking position 7 Map Score: 16.7565 Number of sites scoring better than the average of aligned sites = 1738 Number in coding regions = 1144 Number in noncoding regions = 594 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 3 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.86649e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0