AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i227_rna_methyltransferase_bbur_reg_300.orf -o227_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00237 56 3615 #2 RBB00234 23 3615 #3 RBB00232 158 3615 #4 RBB00836 101 3615 #5 RBB00158 51 3615 Motif number 1 ATCCTTTGTTATTTTTTATGCTTTCA 1 41 0 TTTTTATTTT 0.95005 -16 TAGTGTTATATTGATACATATTGTTAT 3 6 0 TTGTACATTT 0.844306 -153 GATGTATATTTTTCTTAAGCTTTCAGTAATAG 3 35 0 TTTTTAAGTT 0.964977 -124 TTTAATAAAATTGATTCATTTTGAGCATTTGT 3 69 0 TTGTTCATTT 0.912707 -90 ATGAATCAATTTTATTAAATTTCAAGAAAGAA 3 82 1 TTTTTAAATT 0.979921 -77 AAGAAAAAAATTTGTAAAATATTTTTTTTAAA 3 109 1 TTTTAAAAAT 0.921399 -50 GTAAAATATTTTTTTTAAAGATAAAATGCTTT 3 122 1 TTTTTAAAAT 0.95724 -37 TTTTCCTCCTTTGATAAAGCATTTTATCTTTA 3 137 0 TTGTAAAGAT 0.82958 -22 TAATGTATTATTGCTTATTATTTACCT 4 6 0 TTGTTATTTT 0.93318 -96 TATTAATTTTTTTGTTGTAATTTAATGTATTA 4 28 0 TTTTTGTATT 0.809756 -74 TATTAGGGTATTTTTAAAATATGGGTGAGTAT 4 74 0 TTTTAAAAAT 0.921389 -28 ATAAATTAGATTTTTTATTTTTTCAATTTTGA 5 23 1 TTTTTATTTT 0.95005 -29 ACATTTCTCAAAATTGAAAAAATAA 5 37 0 TTTTCAAATT 0.919373 -15 *** ***** ** Masking position 5 Map Score: 15.899 Number of sites scoring better than the average of aligned sites = 2902 Number in coding regions = 1892 Number in noncoding regions = 1010 Number of orfs with sites within 600 bp upstream = 155 Fraction of orfs with sites within 600 bp upstream = 0.0248956 Motif number 2 AATTGAAAGCATAAAAAATAACAAAGGAT 1 38 1 ATAAAAAATA 0.979355 -19 GAAAGCTTAAGAAAAATATACATCTTACAA 3 43 1 GAAAAATATA 0.841866 -116 TTTCAAGAAAGAAAAAAATTTGTAAAATAT 3 101 1 GAAAAAAATT 0.946561 -58 TTTTATCTTTAAAAAAAATATTTTACAAAT 3 118 0 AAAAAAAATA 0.979354 -41 AGGTAAATAATAAGCAATAATA 4 3 1 GTAAATAATA 0.938626 -99 ATAATAAGCAATAATACATTAAATTACAAC 4 17 1 ATAATACATT 0.724712 -85 TTACAACAAAAAAATTAATAGCTTGGCAAA 4 40 1 AAAATTAATA 0.906765 -62 ATAGCTTGGCAAAAATAATACTCACCCATA 4 57 1 AAAAATAATA 0.955513 -45 ACGTACTTAATAATAAATTAGATTTTTTA 5 10 1 ATAATAAATT 0.918482 -42 AATTGAAAAAATAAAAAATCTAATTTATTA 5 21 0 ATAAAAAATC 0.935882 -31 ********** Masking position 4 Map Score: 12.4735 Number of sites scoring better than the average of aligned sites = 2119 Number in coding regions = 1371 Number in noncoding regions = 748 Number of orfs with sites within 600 bp upstream = 143 Fraction of orfs with sites within 600 bp upstream = 0.0229682 Motif number 3 GAATTGGCATGAGTTATATACATA 1 5 0 GAGTTATATA 0.979612 -52 TAGAAAAAAGGAGGTTTATAAT 2 12 1 GAGGTTTATA 0.973131 -12 TTCAGTAATAGTGTTATATTGATACATATT 3 16 0 GTGTTATATT 0.954421 -143 GCATTTGTAAGATGTATATTTTTCTTAAGC 3 47 0 GATGTATATT 0.934203 -112 AAATATGGGTGAGTATTATTTTTGCCAAGC 4 60 0 GAGTATTATT 0.935952 -42 ********** Masking position 7 Map Score: 3.03161 Number of sites scoring better than the average of aligned sites = 82 Number in coding regions = 44 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 8 Fraction of orfs with sites within 600 bp upstream = 0.00128493 Motif number 4 TGTTATTTTTTATGCTTTCAATTATTGAAT 1 31 0 TATGCTTTCA 0.992581 -26 ATATTTTTCTTAAGCTTTCAGTAATAGTGT 3 32 0 TAAGCTTTCA 0.981459 -127 TTACAAATTTTTTTCTTTCTTGAAATTTAA 3 96 0 TTTTCTTTCT 0.931262 -63 TTAGATTTTTTATTTTTTCAATTTTGAGAA 5 28 1 TATTTTTTCA 0.956083 -24 ********** Masking position 6 Map Score: 1.69583 Number of sites scoring better than the average of aligned sites = 84 Number in coding regions = 59 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 5 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.17788e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0