AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i248_cell_division_bbur_reg_100.orf -o248_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00684 79 3615 #2 RBB00663 114 3615 #3 RBB00659 46 3615 #4 RBB00657 36 3615 Motif number 1 AAATATTTTAAAAAAAGGTCAATT 1 2 0 AAAAAGCAAT 0.964161 -78 TTCATATTATAATAAATAAAAATATTTTAAAAA 1 21 0 ATAAAAAAAT 0.978261 -59 CCAATTACTGATAAATCTACAATTTCATATTAT 1 44 0 AAAATTCAAT 0.975965 -36 TTAAAATTAAAAACCAATTACTGATAAA 1 62 0 ATAAAACAAT 0.988774 -18 TAGTATACCAAATAATTATCAATTTAAAAAAAA 2 42 1 ATAATACAAT 0.984106 -73 TTATCAATTTAAAAAAAAAAAATTATTTGATAT 2 57 1 AAAAAAAAAT 0.969125 -58 TTTCAAGCTAAATTATATCAAATAATTTTTTTT 2 71 0 ATTATTAAAT 0.866438 -44 ATCCTTTAGGAGTTAATTTCAAGCTAAATTATA 2 87 0 ATTAATCAAG 0.834184 -28 TAAAAATGAAAGAAAAAATAAATACATTGCTCA 3 21 1 AAAAAAAAAT 0.968692 -26 ATTTAATAATCTGCAATAAAATAGGAG 4 5 1 ATAATTCAAT 0.983423 -32 * **** * **** Masking position 5 Map Score: 15.9325 Number of sites scoring better than the average of aligned sites = 750 Number in coding regions = 511 Number in noncoding regions = 239 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 2 TTTTTTTAAAATATTTTTATTTATTATAAT 1 19 1 ATATTTTTAT 0.875977 -61 CTACAATTTCATATTATAATAAATAAAAAT 1 31 0 ATATTATAAT 0.527017 -49 TCAGTAATTGGTTTTTAATTTTAA 1 66 1 GTTTTTAATT 0.85465 -14 AACCTTACTAATATTAGTATACCAAATAAT 2 28 1 ATATTAGTAT 0.598612 -87 TTTTAAATTGATAATTATTTGGTATACTAA 2 41 0 ATAATTATTT 0.941217 -74 ATTATATCAAATAATTTTTTTTTTTTAAAT 2 63 0 ATAATTTTTT 0.932361 -52 TTTTTCTTTCATTTTTATTTCTCGCTA 3 8 0 ATTTTTATTT 0.942014 -39 TTTGAGCAATGTATTTATTTTTTCTTTCAT 3 26 0 GTATTTATTT 0.949858 -21 TTTATTGCAGATTATTAAAT 4 1 0 ATTATTAAAT 0.749208 -36 GTTTGTTCTCCTATTTTATTGCAGATTATT 4 15 0 CTATTTTATT 0.85137 -22 ********** Masking position 5 Map Score: 7.92114 Number of sites scoring better than the average of aligned sites = 4077 Number in coding regions = 2553 Number in noncoding regions = 1524 Number of orfs with sites within 600 bp upstream = 220 Fraction of orfs with sites within 600 bp upstream = 0.0353357 Motif number 3 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0