AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i255_heat_shock_bbur_reg_300.orf -o255_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00234 23 3615 #2 RBB00232 158 3615 #3 RBB00836 101 3615 #4 RBB00107 107 3615 Motif number 1 ATAGTGTTATATTGATACATATTGTTAT 2 7 0 ATTATAATAT 0.900887 -152 ATTTTGAGCATTTGTAAGATGTATATTTTTCT 2 52 0 TTTTAAATGT 0.970187 -107 ATGAATCAATTTTATTAAATTTCAAGAAAGAA 2 82 1 TTTTTAATTT 0.974289 -77 AAGAAAAAAATTTGTAAAATATTTTTTTTAAA 2 109 1 TTTTAAATAT 0.990632 -50 GTAAAATATTTTTTTTAAAGATAAAATGCTTT 2 122 1 TTTTTAAGAT 0.936833 -37 TATTAGGGTATTTTTAAAATATGGGTGAGTAT 3 74 0 TTTTAAATAT 0.990604 -28 AATTGGTCTTTTAAAAATTTAGGTTTAATT 4 9 1 TTTAAAATTT 0.939105 -99 TTTAGGTTTAATTATAACATATATAAAGTATA 4 28 1 ATTTAAATAT 0.979545 -80 TTTTAAATATATTTTAATATTTATACTTTATA 4 49 0 ATTTAAATTT 0.961709 -59 ATTTATTGTATTTTTTAAATATATTTTAATAT 4 61 0 TTTTTAATAT 0.985377 -47 *** *** **** Masking position 7 Map Score: 18.8584 Number of sites scoring better than the average of aligned sites = 722 Number in coding regions = 435 Number in noncoding regions = 287 Number of orfs with sites within 600 bp upstream = 69 Fraction of orfs with sites within 600 bp upstream = 0.0110826 Motif number 2 AATATGTATCAATATAACACTATTACTGAAAG 2 16 1 AAATAACCTA 0.85039 -143 CTGAAAGCTTAAGAAAAATATACATCTTACAA 2 41 1 AAAAAAAATA 0.98263 -118 AATTTCAAGAAAGAAAAAAATTTGTAAAATAT 2 99 1 AAAAAAAATT 0.970503 -60 TTTTATCTTTAAAAAAAATATTTTACAAATTT 2 116 0 AAAAAAAATT 0.969356 -43 AATAATAAGCAATAATACATTAAATTACAACA 3 16 1 AAAATACTTA 0.908821 -86 ATTAAATTACAACAAAAAAATTAATAGCTTGG 3 34 1 AAAAAAAATT 0.97106 -68 ATAGCTTGGCAAAAATAATACTCACCCATATT 3 57 1 AAAATAAACT 0.881076 -45 CCCATATTTTAAAAATACCCTAATATTAAAG 3 81 1 AAAATACCTA 0.964589 -21 ATTTAGGTTTAATTATAACATATATAAAGTAT 4 27 1 AATATAAATA 0.895622 -81 ATAAAGTATAAATATTAAAATATATTTAAAAA 4 50 1 AAATTAAATA 0.913437 -58 AATATATTTAAAAAATACAATAAATAAGGTAG 4 68 1 AAAATACATA 0.984433 -40 ** ***** *** Masking position 7 Map Score: 15.3801 Number of sites scoring better than the average of aligned sites = 1203 Number in coding regions = 766 Number in noncoding regions = 437 Number of orfs with sites within 600 bp upstream = 86 Fraction of orfs with sites within 600 bp upstream = 0.013813 Motif number 3 ATTATAAACCTCCTTTTTTCTAA 1 9 0 AAACCTCCTT 0.959392 -15 GTAAGATGTATATTTTTCTTAAGCTTTCAG 2 41 0 TATTTTTCTT 0.890072 -118 TACAAATTTTTTTCTTTCTTGAAATTTAAT 2 95 0 TTTCTTTCTT 0.927761 -64 TTGATAAAGCATTTTATCTTTAAAAAAAAT 2 129 0 ATTTTATCTT 0.778875 -30 TTTTCCTCCTTTGATAAAGCA 2 148 0 TTTCCTCCTT 0.969726 -11 AATCTCCTTCAATCTACCTTATTTATTGTA 4 83 0 AATCTACCTT 0.951314 -25 TAAAAAATCTCCTTCAATCTACCT 4 94 0 AAATCTCCTT 0.919609 -14 ********** Masking position 9 Map Score: 4.02072 Number of sites scoring better than the average of aligned sites = 491 Number in coding regions = 323 Number in noncoding regions = 168 Number of orfs with sites within 600 bp upstream = 28 Fraction of orfs with sites within 600 bp upstream = 0.00449727 Motif number 4 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 4.92707e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0