AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i284_hypothetical9_bbur_reg_100.orf -o284_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00992 109 4091 #2 RBB00993 35 4091 #3 RBB00995 46 4091 Motif number 1 TATTTCTATAAAATTTGATTTATCAATAT 1 9 1 TAAAATTGAT 0.959646 -101 AATCTAATAATAAAATATATTGATAAATCAA 1 25 0 TAAAATTATT 0.985367 -85 ATTATTAGATTAAAATCCAATAAATAGCGTT 1 45 1 TAAAATCAAT 0.960999 -65 ATTTTTGATATAAAATAAAATTTGAGGAGTA 1 82 1 TAAAATAAAT 0.982046 -28 GCCTTTAAAAAGAATTAAAAGCCTAA 2 6 1 TAAAAAAATT 0.969791 -30 ATTAAAAGCCTAATAATTATTA 2 24 1 TAATAATATT 0.937936 -12 TTAATATAAATACTCTCCTTTC 3 2 1 TAATATAATA 0.907205 -45 CTGTATTGTATAATATAAGTTAATT 3 32 1 TAATATAGTT 0.968716 -15 ****** **** Masking position 5 Map Score: 11.9941 Number of sites scoring better than the average of aligned sites = 1078 Number in coding regions = 633 Number in noncoding regions = 445 Number of orfs with sites within 600 bp upstream = 130 Fraction of orfs with sites within 600 bp upstream = 0.0208802 Motif number 2 TTCTATAAAATTTGATTTATCAATATATTT 1 14 1 TTTGATTTAT 0.982121 -96 TATTTTATTATTAGATTAAAATCCAATAAA 1 39 1 TTAGATTAAA 0.759574 -71 ATAAATAGCGTTGGTTTTATTTTTGATATA 1 64 1 TTGGTTTTAT 0.962815 -46 TGGTTTTATTTTTGATATAAAATAAAATTT 1 75 1 TTTGATATAA 0.906051 -35 ********** Masking position 6 Map Score: 1.56597 Number of sites scoring better than the average of aligned sites = 279 Number in coding regions = 181 Number in noncoding regions = 98 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0