AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i284_hypothetical9_bbur_reg_300.orf -o284_borburg_300.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00992 109 4091 #2 RBB00993 35 4091 #3 RBB00995 46 4091 Motif number 1 ATATTGATAAATCAAATTTTATAGAAATA 1 9 0 ATCAATTTTA 0.961411 -101 TTGATTTATCAATATATTTTATTATTAGATT 1 25 1 AATAATTTTA 0.986022 -85 AACGCTATTTATTGGATTTTAATCTAATAAT 1 45 0 ATTGATTTTA 0.962708 -65 TACTCCTCAAATTTTATTTTATATCAAAAAT 1 82 0 ATTTATTTTA 0.982849 -28 TTAGGCTTTTAATTCTTTTTAAAGGC 2 6 0 AATTTTTTTA 0.971125 -30 TAATAATTATTAGGCTTTTAAT 2 24 0 AATATTATTA 0.940502 -12 GAAAGGAGAGTATTTATATTAA 3 2 0 TATTATATTA 0.911032 -45 AATTAACTTATATTATACAATACAG 3 32 0 AACTATATTA 0.970096 -15 **** ****** Masking position 11 Map Score: 11.9941 Number of sites scoring better than the average of aligned sites = 1078 Number in coding regions = 633 Number in noncoding regions = 445 Number of orfs with sites within 600 bp upstream = 130 Fraction of orfs with sites within 600 bp upstream = 0.0208802 Motif number 2 AATATATTGATAAATCAAATTTTATAGAAA 1 13 0 TAAATCAAAT 0.929456 -97 ATCTAATAATAAAATATATTGATAAATCAA 1 25 0 AAAATATATT 0.744404 -85 TTATTAGATTAAAATCCAATAAATAGCGTT 1 46 1 AAAATCCAAT 0.958663 -64 TTTTATATCAAAAATAAAACCAACGCTATT 1 67 0 AAAATAAAAC 0.971789 -43 TTTTTGATATAAAATAAAATTTGAGGAGTA 1 83 1 AAAATAAAAT 0.988831 -27 TTAATATAAATACTCTCCTTTC 3 3 1 AATATAAATA 0.833098 -44 TGTATTGTATAATATAAGTTAATT 3 33 1 AATATAAGTT 0.869817 -14 ********** Masking position 4 Map Score: 6.37158 Number of sites scoring better than the average of aligned sites = 2621 Number in coding regions = 1686 Number in noncoding regions = 935 Number of orfs with sites within 600 bp upstream = 172 Fraction of orfs with sites within 600 bp upstream = 0.0276261 Motif number 3 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.51646e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0