AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i321_mixed6_bbur_reg_100.orf -o321_borburg_100.ace -a/home/amcguire/genomes/ORF_borburg.txt -z/home/amcguire/genomes/borburg.fna -g0.28 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.28 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RBB00547 300 3615 Motif number 1 AAAAAGTCTAACAAAAAAATCTAAAATT 1 3 0 AAAAAATAAA 0.986802 -298 GGGAATCTACACAAAACTTATTAAAAAGTCTAACAA 1 25 0 AAAAATAAAA 0.939786 -276 TTAAAATAAAACATAAATATGGGAATCTACACAAAA 1 45 0 AATAAATAAT 0.946129 -256 AAGCAGTTTTAAAAAAGAATGTTAAAATAAAACATA 1 66 0 AAAAAATAAA 0.986803 -235 AACTGCTTTTATTAAATAAATAGAATAAGCGTGATT 1 94 1 ATAAAAAAAT 0.824073 -207 AGCGTGATTAAAAAAATCAATTATATTTTTTCATGT 1 121 1 AAAAAAATAT 0.948816 -180 TTTATTATATAAAAAAACATGAAAAAATATAATTGA 1 137 0 AAAAAATAAA 0.986809 -164 ATGTTTTTTTATATAATAAATGTTATTAAGTTGGAT 1 153 1 AATAAAATAT 0.795534 -148 TATAAATACAACAAAACCTAATTTAACTTTAATATC 1 186 0 AAAAATATAA 0.902052 -115 AACACACCGCAAATAATAATACGTAAAGCTCAATTT 1 225 0 AATAAATTAA 0.946146 -76 TATATCTTTGATAAACCGATTTAAAAGGGGTATTT 1 276 1 AAAACATAAA 0.933667 -25 * **** ** *** Masking position 5 Map Score: 13.6773 Number of sites scoring better than the average of aligned sites = 2374 Number in coding regions = 1483 Number in noncoding regions = 891 Number of orfs with sites within 600 bp upstream = 131 Fraction of orfs with sites within 600 bp upstream = 0.0210408 Motif number 2 GTCTAACAAAAAAATCTAAAATT 1 3 0 AAAATCAAAA 0.931911 -298 AACTTATTAAAAAGTCTAACAAAAAAATCTA 1 16 0 AAAGTCAACA 0.9557 -285 AAAGAATGTTAAAATAAAACATAAATATGGG 1 58 0 AAAATAAACA 0.983825 -243 TTTTATTAAATAAATAGAATAAGCGTGATTA 1 100 1 TAAATAAATA 0.915009 -201 AAAACATGAAAAAATATAATTGATTTTTTTA 1 129 0 AAAATAAATT 0.941995 -172 TAACATTTATTATATAAAAAAACATGAAAAA 1 147 0 TATATAAAAA 0.703625 -154 ATTTAACTTTAATATCCAACTTAATAACATT 1 171 0 AATATCAACT 0.915465 -130 GTTGGATATTAAAGTTAAATTAGGTTTTGTT 1 182 1 AAAGTTAATT 0.591689 -119 AATTTATATATAAATACAACAAAACCTAATT 1 199 0 TAAATAAACA 0.964965 -102 CGGTTTATCAAAGATATAACTTCAACTACCT 1 263 0 AAGATAAACT 0.91691 -38 ****** **** Masking position 5 Map Score: 9.40029 Number of sites scoring better than the average of aligned sites = 1586 Number in coding regions = 1016 Number in noncoding regions = 570 Number of orfs with sites within 600 bp upstream = 123 Fraction of orfs with sites within 600 bp upstream = 0.0197559 Motif number 3 CTACACAAAACTTATTAAAAAGTCTAACAAA 1 24 0 CTATTAAAAA 0.978229 -277 TTAATAAAAGCAGTTTTAAAAAAGAATGTTA 1 78 0 CGTTTTAAAA 0.917361 -223 TAAAACTGCTTTTATTAAATAAATAGAATAA 1 91 1 TTATTAAATA 0.801528 -210 TAGAATAAGCGTGATTAAAAAAATCAATTAT 1 114 1 GGATTAAAAA 0.968907 -187 TAACATTTATTATATAAAAAAACATGAAAAA 1 147 0 TTATAAAAAA 0.801528 -154 CTTTGATAAACCGATTTAAAAGGGGTATTT 1 281 1 CGATTTAAAA 0.978269 -20 * ********* Masking position 5 Map Score: 2.2301 Number of sites scoring better than the average of aligned sites = 635 Number in coding regions = 425 Number in noncoding regions = 210 Number of orfs with sites within 600 bp upstream = 42 Fraction of orfs with sites within 600 bp upstream = 0.0067459 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0