AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i064_Histidine_Biosynthesis_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 hisZ 250 histidyl-tRNA synthetase Motif number 1 CTTTATCTCCTTGTTCTCTATT 1 1 1 CTTTACTCTT 0.980254 -250 TCTCCTTGTTCTCTATTTGATTTGTATTATAG 1 16 1 CTCTATTGTT 0.93785 -235 TACGTAATATCTCAAATTCTTTATGTTTGGCA 1 50 0 CTCAATTCTT 0.970431 -201 TATTACGTACCTTTAATACATTATTCATGATT 1 73 1 CTTTATACTT 0.971009 -178 GTAAGGATATTTTTAGTTCAAATATCCTTCTC 1 118 0 TTTTATTCAA 0.819555 -133 AAAATCAACGCTTAACTTCAGTAAGGATATTT 1 138 0 CTTAATTCGT 0.953831 -113 TAAGCGTTGATTTTCATTCTTTCATCTGCTAA 1 156 1 TTTTCTTCTT 0.971459 -95 ATTCCGAATCCTTTAGTTCGCTAATATGATAA 1 192 0 CTTTATTCCT 0.984934 -59 GGATTCGGAATTTTCCTTCATAAGATAACAGC 1 213 1 TTTTCTTCTA 0.914938 -38 ***** *** ** Masking position 2 Map Score: 7.09854 Number of sites scoring better than the average of aligned sites = 1182 Number in coding regions = 966 Number in noncoding regions = 216 Number of orfs with sites within 600 bp upstream = 228 Fraction of orfs with sites within 600 bp upstream = 0.0366206 Motif number 2 ATTTGATTTGTATTATAGCATGCCAAACATAAAGAAT 1 30 1 TTTAAATGAA 0.936983 -221 TACGTACCTTTAATACATTATTCATGATTTTTTCATA 1 76 1 TATAAATTGA 0.894796 -175 TTATTCATGATTTTTTCATAATGAGGAGAAGGATATT 1 93 1 TTTTCAATGA 0.916767 -158 TATGATAATATGTTAGCAGATGAAAGAATGAAAATCA 1 163 0 TTTACATGGA 0.99635 -88 TCTGCTAACATATTATCATATTAGCGAACTAAAGGAT 1 180 1 TTTACATTGA 0.994504 -71 GCACCTCCGCTGTTATCTTATGAAGGAAAATTCCGAA 1 216 0 TTTACATGGA 0.996323 -35 * *** * *** ** Masking position 10 Map Score: 2.74502 Number of sites scoring better than the average of aligned sites = 165 Number in coding regions = 130 Number in noncoding regions = 35 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 3 CAAATAGAGAACAAGGAGATAAAG 1 5 0 ACAAGGAGAT 0.986802 -246 CATAATGAGGAGAAGGATATTTGAACTAAA 1 109 1 AGAAGGATAT 0.979427 -142 CTTAACTTCAGTAAGGATATTTTTAGTTCA 1 130 0 GTAAGGATAT 0.988553 -121 ATGATAATATGTTAGCAGATGAAAGAATGA 1 169 0 GTTAGCAGAT 0.953105 -82 ********** Masking position 4 Map Score: 0.980586 Number of sites scoring better than the average of aligned sites = 154 Number in coding regions = 117 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 38 Fraction of orfs with sites within 600 bp upstream = 0.00610344 Motif number 4 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -2.7468e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0