AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i138_Transmembrane_Transport_11_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ycdH 187 similar to adhesion protein #2 ycdI 55 similar to ABC transporter (ATP-binding protein) Motif number 1 AAGTAGCCCGGCATTTTTAGCCGGGTTTTT 1 17 1 GCATTTTTAG 0.973551 -171 TTTTAGCCGGGTTTTTTTAGTACATATATT 1 31 1 GTTTTTTTAG 0.885208 -157 AGAATAAATTTCATTTTCATTTATTTTTCC 1 74 0 TCATTTTCAT 0.976172 -114 TGACTTCGGTTTATTATGATATAGGATTAC 1 116 1 TTATTATGAT 0.800638 -72 AAAATCGTTATCATTTTGATTTAAAGTTAC 1 146 1 TCATTTTGAT 0.983518 -42 GTATATCCCCTCTTTTTCAGTAACTTTAAA 1 165 0 TCTTTTTCAG 0.984844 -23 GCACACTATTTCTTTGTGAGAAAGGAAGAT 2 32 1 TCTTTGTGAG 0.971917 -24 ********** Masking position 9 Map Score: 7.15963 Number of sites scoring better than the average of aligned sites = 1558 Number in coding regions = 1331 Number in noncoding regions = 227 Number of orfs with sites within 600 bp upstream = 240 Fraction of orfs with sites within 600 bp upstream = 0.038548 Motif number 2 CTGCAGGCGGGAAAAATAAATGAAAATGAA 1 65 1 GAAAAATAAA 0.969487 -123 AAAAATAAATGAAAATGAAATTTATTCTTG 1 76 1 GAAAATGAAA 0.984988 -112 TTACGTTTTGCAAGAATAAATTTCATTTTC 1 86 0 CAAGAATAAA 0.965617 -102 TTTATTCTTGCAAAACGTAATGACTTCGGT 1 96 1 CAAAACGTAA 0.913022 -92 AACTTTAAATCAAAATGATAACGATTTTGT 1 144 0 CAAAATGATA 0.947067 -44 CTTCCTTTCTCACAAAGAAATAGTGTGCAC 2 30 0 CACAAAGAAA 0.963667 -26 TGTGAGAAAGGAAGATTAAC 2 46 1 GAAGATTAAC 0.867988 -10 ********** Masking position 5 Map Score: 5.08577 Number of sites scoring better than the average of aligned sites = 1764 Number in coding regions = 1434 Number in noncoding regions = 330 Number of orfs with sites within 600 bp upstream = 335 Fraction of orfs with sites within 600 bp upstream = 0.0538066 Motif number 3 TTATGATATAGGATTACAAAATCGTTATCATT 1 129 1 GGTTACAAAT 0.976731 -59 TGAAAAAGAGGGGATATACGAT 1 176 1 GGATATACAT 0.976668 -12 GCACCCCTCCGGCGCACACTATC 2 2 0 GGGCACACAT 0.998575 -54 GCGCCGGAGGGGTGCACACTATTTCTTTGTGA 2 19 1 GGGCACACAT 0.998575 -37 ** ****** ** Masking position 6 Map Score: 2.59991 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 37 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 AACCCGGCTAAAAATGCCGGGCTACTTCAA 1 14 0 AAAATGCCGG 0.995755 -174 TATGTACTAAAAAAACCCGGCTAAAAATGC 1 27 0 AAAAACCCGG 0.995571 -161 AAAGTTACTGAAAAAGAGGGGATATACGAT 1 168 1 AAAAAGAGGG 0.98801 -20 ********** Masking position 4 Map Score: 1.5764 Number of sites scoring better than the average of aligned sites = 251 Number in coding regions = 204 Number in noncoding regions = 47 Number of orfs with sites within 600 bp upstream = 37 Fraction of orfs with sites within 600 bp upstream = 0.00594282 Motif number 5 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.30951e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0