AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i142_Cytochrome_Oxidase_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ctaC 239 cytochrome caa3 oxidase (subunit II) #2 ctaD 32 cytochrome caa3 oxidase (subunit I) Motif number 1 TGAAGCGATAAAACAAGCATCATATCTATT 1 13 0 AAACAAGCAT 0.842042 -227 CCGCCTGATTAAACAAGAGGTCAAGGCGGC 1 68 0 AAACAAGAGG 0.985264 -172 CCTCTTGTTTAATCAGGCGGCTTTACTTTT 1 78 1 AATCAGGCGG 0.974206 -162 TCATAATTTAAGAGAAGAGGAAATGTAAGT 1 138 1 AGAGAAGAGG 0.975138 -102 TCTGGTCAATACAAAGGCGGAAAGCGGATC 1 204 0 ACAAAGGCGG 0.985479 -36 TGTATTGACCAGAAAAGGGGTTGGGTGAA 1 221 1 AGAAAAGGGG 0.990424 -19 GGAAGAAAGGGAGATATTGGGGG 2 4 1 AGAAAGGGAG 0.971487 -29 ********** Masking position 5 Map Score: 6.4464 Number of sites scoring better than the average of aligned sites = 1801 Number in coding regions = 1425 Number in noncoding regions = 376 Number of orfs with sites within 600 bp upstream = 403 Fraction of orfs with sites within 600 bp upstream = 0.0647286 Motif number 2 GACAACTAGTAAATGCCGCCTTGACCTCTT 1 54 1 AAATGCCGCC 0.996106 -186 TGTATAAAAGTAAAGCCGCCTGATTAAACA 1 83 0 TAAAGCCGCC 0.993157 -157 TTTTTACTCAAAATGCCATCTATGTATAAA 1 105 0 AAATGCCATC 0.990533 -135 GATCGAAATCTATCGCCATCCAACCTATCA 1 178 0 TATCGCCATC 0.971155 -62 ********** Masking position 2 Map Score: 3.22928 Number of sites scoring better than the average of aligned sites = 272 Number in coding regions = 247 Number in noncoding regions = 25 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 3 AAAATAGATATGATGCTTGTTTTA 1 5 1 TAGATATGAT 0.80215 -235 CGGCATTTACTAGTTGTCATCGTTTATTTT 1 42 0 TAGTTGTCAT 0.958116 -198 ACAAGAGGTCAAGGCGGCATTTACTAGTTG 1 56 0 AAGGCGGCAT 0.983329 -184 CTTGTTTAATCAGGCGGCTTTACTTTTATA 1 81 1 CAGGCGGCTT 0.959221 -159 CTTTTATACATAGATGGCATTTTGAGTAAA 1 103 1 TAGATGGCAT 0.991569 -137 TTATTGGTGATAGGTTGGATGGCGATAGAT 1 171 1 TAGGTTGGAT 0.964337 -69 ********** Masking position 2 Map Score: 2.35171 Number of sites scoring better than the average of aligned sites = 714 Number in coding regions = 621 Number in noncoding regions = 93 Number of orfs with sites within 600 bp upstream = 80 Fraction of orfs with sites within 600 bp upstream = 0.0128493 Motif number 4 AAATCTATCGCCATCCAACCTATCACCAAT 1 173 0 CCATCCAACC 0.991216 -67 TTCACCCAACCCCTTTTCTGG 1 229 0 TCACCCAACC 0.997277 -11 ATGTGACCTCCCCCAATATCTCCCTTTC 2 15 0 TCCCCCAATA 0.976399 -18 ********** Masking position 7 Map Score: 0.0190475 Number of sites scoring better than the average of aligned sites = 39 Number in coding regions = 28 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.31523e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0