AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i233_protein_modification____bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ydiA 300 alternate gene name: ydxA; similar to thiamin-monophosphate kinase Motif number 1 CTAAGGGTGCAACCAAAATAATCCTATACA 1 19 1 AACCAAAATA 0.974538 -282 CAGGCATTCTAACCAACTGAACTACCGGAC 1 55 0 AACCAACTGA 0.92065 -246 CATTAATGTAAACGAAACGATCATGTTTTC 1 129 1 AACGAAACGA 0.97918 -172 ACACAAAAAAAACGAAAACATGATCGTTTC 1 142 0 AACGAAAACA 0.993467 -159 AGATACAGTAAAAGAAAACACAAAAAAAAC 1 159 0 AAAGAAAACA 0.959226 -142 GAACCAAAACCTCCTTTCAAC 1 290 0 AACCAAAACC 0.982333 -11 ********** Masking position 5 Map Score: 5.93158 Number of sites scoring better than the average of aligned sites = 324 Number in coding regions = 285 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 2 AACTGAACTACCGGACCATATTTGTATAGGA 1 40 0 CCGGACCTAT 0.982242 -261 CGACCTCCTGCGTGACAGGCAGGCATTCTAA 1 73 0 CGTGACAGCA 0.946777 -228 GACTCGAACCCGCGACCTCCTGCGTGACAGG 1 85 0 CGCGACCCCT 0.99277 -216 GCGGTCCGGACGGGACTCGAACCCGCGACCT 1 98 0 CGGGACTGAA 0.968984 -203 CGAGTCCCGTCCGGACCGCCATTAATGTAAA 1 110 1 CCGGACCCCA 0.996066 -191 TTCTTTATATCGGGAACATCTTGGATATTCC 1 213 1 CGGGAACTCT 0.979778 -88 ******* *** Masking position 5 Map Score: 3.18142 Number of sites scoring better than the average of aligned sites = 450 Number in coding regions = 410 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 TTGGTTAGAATGCCTGCCTGTCACGCAGGA 1 69 1 TGCCTGCCTG 0.987553 -232 AACCCGCGACCTCCTGCGTGACAGGCAGGC 1 80 0 CTCCTGCGTG 0.99657 -221 TTTACTGTATCTTCTGCTTGGTGTCATAGC 1 177 1 CTTCTGCTTG 0.99221 -124 TTCAACCCTGCTTATGCCTATTTGTGCTCT 1 266 0 CTTATGCCTA 0.956542 -35 ********** Masking position 5 Map Score: 1.34217 Number of sites scoring better than the average of aligned sites = 357 Number in coding regions = 321 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0