AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i238_sensory_cassete4_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yclJ 212 similar to two-component response regulator [YclK] Motif number 1 GTATAGGTATTTTTATTGATAAGACCGCCT 1 23 1 TTTTATTGAT 0.97358 -190 ATTGTTCATATTTTTTTCATACCTTTGGAC 1 88 0 TTTTTTTCAT 0.991815 -125 ATTGTTAGTTTTTATTTCATCAACTAGAAA 1 121 0 TTTATTTCAT 0.973565 -92 GTTTTGATGCTTTTTTATATAATAGCACCA 1 179 0 TTTTTTATAT 0.931245 -34 TATCCTCCGGTTGTTTTGATGCTTTTTTAT 1 191 0 TTGTTTTGAT 0.98202 -22 ********** Masking position 6 Map Score: 5.60374 Number of sites scoring better than the average of aligned sites = 448 Number in coding regions = 325 Number in noncoding regions = 123 Number of orfs with sites within 600 bp upstream = 126 Fraction of orfs with sites within 600 bp upstream = 0.0202377 Motif number 2 TCTTATCAATAAAAATACCTATACGGAGGA 1 17 0 AAAAATACCT 0.917697 -196 ATAGTAGTCCAAAGGTATGAAAAAAATATG 1 82 1 AAAGGTATGA 0.900452 -131 AAGGTATGAAAAAAATATGAACAATCTATT 1 93 1 AAAAATATGA 0.928804 -120 TGATGAAATAAAAACTAACAATTGTGAAAC 1 129 1 AAAACTAACA 0.935639 -84 TGTGAAACGCAAAACCTTCTGTTTAAAATG 1 151 1 AAAACCTTCT 0.838546 -62 TTTTTTATATAATAGCACCATTTTAAACAG 1 169 0 AATAGCACCA 0.935401 -44 TATTATATAAAAAAGCATCAAAACAACCGG 1 185 1 AAAAGCATCA 0.988229 -28 ********** Masking position 2 Map Score: 2.62495 Number of sites scoring better than the average of aligned sites = 2015 Number in coding regions = 1680 Number in noncoding regions = 335 Number of orfs with sites within 600 bp upstream = 281 Fraction of orfs with sites within 600 bp upstream = 0.0451333 Motif number 3 AAAAATACCTATACGGAGGAACATAA 1 7 0 ATACGGAGGA 0.982481 -206 ATTAATAGTAGTCCAAAGGTATGAAAAAAA 1 78 1 GTCCAAAGGT 0.955086 -135 CACCATTTTAAACAGAAGGTTTTGCGTTTC 1 154 0 AACAGAAGGT 0.973129 -59 GCATCAAAACAACCGGAGGATATA 1 199 1 AACCGGAGGA 0.995529 -14 ********** Masking position 7 Map Score: 0.947543 Number of sites scoring better than the average of aligned sites = 332 Number in coding regions = 293 Number in noncoding regions = 39 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 4 CTTGCTGATAAATTAATAGTAGTCCAAAGG 1 67 1 AATTAATAGT 0.9754 -146 ATCAACTAGAAATAGATTGTTCATATTTTT 1 103 0 AATAGATTGT 0.973529 -110 TGCGTTTCACAATTGTTAGTTTTTATTTCA 1 132 0 AATTGTTAGT 0.983379 -81 ********** Masking position 2 Map Score: 0.267211 Number of sites scoring better than the average of aligned sites = 47 Number in coding regions = 38 Number in noncoding regions = 9 Number of orfs with sites within 600 bp upstream = 12 Fraction of orfs with sites within 600 bp upstream = 0.0019274 Motif number 5 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.15595e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0