AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i240_sensory_cassete6_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 lytS 166 two-component sensor histidine kinase Motif number 1 TCTATTGTAAAATAAAACATGAGCCTTTTG 1 47 0 AATAAAACAT 0.975456 -120 TTAAAATCGTCTGAAAACATATTTCACAAG 1 84 0 CTGAAAACAT 0.984194 -83 AGACGATTTTAAAAAAACAGTCAGCCGCAA 1 102 1 AAAAAAACAG 0.977225 -65 CAGCCGCAAAACGAAAACATGCTAGAATGA 1 123 1 ACGAAAACAT 0.991704 -44 ACATGCTAGAATGAAAACGGAAAGAACAGG 1 139 1 ATGAAAACGG 0.986462 -28 ********** Masking position 5 Map Score: 5.83853 Number of sites scoring better than the average of aligned sites = 662 Number in coding regions = 582 Number in noncoding regions = 80 Number of orfs with sites within 600 bp upstream = 91 Fraction of orfs with sites within 600 bp upstream = 0.0146161 Motif number 2 GCTCATGTTTTATTTTACAATAGATAAAAG 1 53 1 TATTTTACAA 0.992251 -114 TCTGAAAACATATTTCACAAGGCTTTTATC 1 75 0 TATTTCACAA 0.990891 -92 GTTTTCAGACGATTTTAAAAAAACAGTCAG 1 96 1 GATTTTAAAA 0.976395 -71 ********** Masking position 7 Map Score: 2.25503 Number of sites scoring better than the average of aligned sites = 105 Number in coding regions = 78 Number in noncoding regions = 27 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -2.8889e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0