AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i262_3_5_1_28_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ydiA 300 alternate gene name: ydxA; similar to thiamin-monophosphate kinase #2 lytC 38 N-acetylmuramoyl-L-alanine amidase (major autolysin) (CWBP49) #3 lytB 23 modifier protein of major autolysin LytC (CWBP76) #4 lytA 183 membrane bound lipoprotein Motif number 1 GATTATTTTGGTTGCACCCTTAGGGCACTC 1 12 0 GTTGCACCCT 0.989263 -289 CAAAACCTCCTTTCAACCCTGCTTATGCCT 1 277 0 TTTCAACCCT 0.961604 -24 TTGATTTCCTCCTTAAATGGCGTT 2 25 0 TTTCCTCCTT 0.9822 -14 AATTTCAGGTTCCTCCCTATATC 3 6 0 GTTCCTCCCT 0.986289 -18 CCTTTGCACCTCGTCTGTTAAA 4 3 1 TTTGCACCTC 0.98322 -181 TTTTTTCACCTCATTATATTTT 4 172 0 TTTTCACCTC 0.955521 -12 ********** Masking position 3 Map Score: 5.94742 Number of sites scoring better than the average of aligned sites = 242 Number in coding regions = 154 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 107 Fraction of orfs with sites within 600 bp upstream = 0.017186 Motif number 2 CATTAATGTAAACGAAACGATCATGTTTTCG 1 129 1 AACGAAAGAT 0.94286 -172 ACACAAAAAAAACGAAAACATGATCGTTTCG 1 141 0 AACGAAACAT 0.986303 -160 AGATACAGTAAAAGAAAACACAAAAAAAACG 1 158 0 AAAGAAACAC 0.92403 -143 TTCCCGATATAAAGAAAGCTTGGCTATGACA 1 198 0 AAAGAAACTT 0.978624 -103 GAACCAAAACCTCCTTTCAACC 1 289 0 AACCAAACCT 0.927877 -12 TTAATACAAGAATGAAATCCTAAAATAGTCG 4 76 1 AATGAAACCT 0.97183 -108 ATTAAGAAACAATGAAACTTTTTTTTATAAA 4 110 0 AATGAAATTT 0.831459 -74 TTTATATTTTAAAGAAAAATTAAGAAACAAT 4 128 0 AAAGAAAATT 0.876298 -56 ******* *** Masking position 6 Map Score: 6.12245 Number of sites scoring better than the average of aligned sites = 561 Number in coding regions = 479 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 99 Fraction of orfs with sites within 600 bp upstream = 0.0159011 Motif number 3 AAGAAAACACAAAAAAAACGAAAACATGAT 1 148 0 AAAAAAAACG 0.884657 -153 GCAAAATTCGATAAACTAGGAAGAGCACAA 1 245 1 ATAAACTAGG 0.909381 -56 CTAGGAAGAGCACAAATAGGCATAAGCAGG 1 260 1 CACAAATAGG 0.789637 -41 TTAAATTTCCAATAAATACAACTCTATTTA 4 49 1 AATAAATACA 0.676613 -135 TCATTCTTGTATTAAATAGAGTTGTATTTA 4 61 0 ATTAAATAGA 0.855988 -123 GAATGAAATCCTAAAATAGTCGTTTTTTAT 4 85 1 CTAAAATAGT 0.849495 -99 ACTTTTTTTTATAAAAAACGACTATTTTAG 4 95 0 ATAAAAAACG 0.918226 -89 CGTTTTTTATAAAAAAAAGTTTCATTGTTT 4 105 1 AAAAAAAAGT 0.802369 -79 TCTTTAAAATATAAAATAGGTTGACGATAA 4 144 1 ATAAAATAGG 0.979642 -40 TAGGTTGACGATAAAATATAATGAGGTGAA 4 160 1 ATAAAATATA 0.709283 -24 ********** Masking position 5 Map Score: 4.66146 Number of sites scoring better than the average of aligned sites = 1709 Number in coding regions = 1237 Number in noncoding regions = 472 Number of orfs with sites within 600 bp upstream = 484 Fraction of orfs with sites within 600 bp upstream = 0.0777385 Motif number 4 GGTTAGAATGCCTGCCTGTCACGCAGGAGGTC 1 71 1 CCTGCCTGTC 0.995037 -230 ATAAAGAAAGCTTGGCTATGACACCAAGCAGA 1 189 0 CTTGGCTATC 0.99268 -112 TCGGGAACATCTTGGATATTCCAGCAAAATTC 1 222 1 CTTGGATATC 0.971536 -79 TCCTTTCAACCCTGCTTATGCCTATTTGTGCT 1 268 0 CCTGCTTATC 0.991152 -33 ATTTCAGGTTCCTCCCTATATC 3 1 0 CCTCCCTATC 0.992151 -23 ********* * Masking position 7 Map Score: 2.73882 Number of sites scoring better than the average of aligned sites = 81 Number in coding regions = 65 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 5 CCTATACAAATATGGTCCGGTAGTTCAGTT 1 41 1 TATGGTCCGG 0.980632 -260 CTGTCACGCAGGAGGTCGCGGGTTCGAGTC 1 86 1 GGAGGTCGCG 0.984858 -215 TTACATTAATGGCGGTCCGGACGGGACTCG 1 110 0 GGCGGTCCGG 0.996175 -191 GAATATCCAAGATGTTCCCGATATAAAGAA 1 213 0 GATGTTCCCG 0.980629 -88 ********** Masking position 6 Map Score: 0.171007 Number of sites scoring better than the average of aligned sites = 110 Number in coding regions = 103 Number in noncoding regions = 7 Number of orfs with sites within 600 bp upstream = 5 Fraction of orfs with sites within 600 bp upstream = 0.000803084 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0