AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i277_hypothetical21_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yhdX 233 yhdX #2 yhdY 148 similar to hypothetical proteins #3 yqjK 226 similar to hypothetical proteins Motif number 1 AACTGGTGAATTTTTTCTGCCATATCGGAA 1 77 1 TTTTTTCTGC 0.987127 -157 TCTGACGAAATGTGTTCTGATACGCTGAGT 1 145 0 TGTGTTCTGA 0.942481 -89 AGGATCATATTTTGTTGTGAACATGTCGAA 1 186 0 TTTGTTGTGA 0.911348 -48 TCGCCGGGGTTTTGTGCTGCATAAGACATT 2 63 1 TTTGTGCTGC 0.966093 -86 ATTTAAGCCCTTTTTTAAGCAGAATGCTGA 3 99 1 TTTTTTAAGC 0.90109 -128 GCTAGAAACATTTTTTCAGCATTCTGCTTA 3 114 0 TTTTTTCAGC 0.983299 -113 AAAGGATTGTTCTTTTCAGAGGCAAGATTC 3 147 1 TCTTTTCAGA 0.908808 -80 ********** Masking position 5 Map Score: 5.11383 Number of sites scoring better than the average of aligned sites = 1290 Number in coding regions = 1152 Number in noncoding regions = 138 Number of orfs with sites within 600 bp upstream = 145 Fraction of orfs with sites within 600 bp upstream = 0.0232894 Motif number 2 TAGCAAAAAAGGAGGCGAGATC 1 222 1 GGAGGCGAGA 0.996866 -12 TGATTGGGATAGAGGGGAGACAGTC 2 134 1 AGAGGGGAGA 0.991129 -15 TGTTCTTTTCAGAGGCAAGATTCACATTTT 3 154 1 AGAGGCAAGA 0.992533 -73 GGTTCTAGTAGGAGGAAGGAAAC 3 214 1 GGAGGAAGGA 0.977885 -13 ********** Masking position 3 Map Score: 3.16191 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 40 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 3 TGGGCATTTCTGTTATTGTATCAAATCCAT 1 30 1 TGTTATTGTA 0.930689 -204 TCCTTACGAATATTTTAGTATAATAAACAA 2 103 1 TATTTTAGTA 0.96707 -46 TTCGAAGCTTTATTTTAGTACACCCCGTAT 3 29 1 TATTTTAGTA 0.96707 -198 CTTGATCCTGTATTCTTGTAGGTATCTGGT 3 187 1 TATTCTTGTA 0.971296 -40 GTAGGTATCTGGTTCTAGTAGGAGGAAGGA 3 204 1 GGTTCTAGTA 0.959484 -23 ********** Masking position 6 Map Score: 2.73476 Number of sites scoring better than the average of aligned sites = 56 Number in coding regions = 37 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 4 GCATTCCTCAGCCCGGACCATTCCGATATG 1 97 0 GCCCGGACCA 0.953269 -137 TAGGTCTTTCGACATGTTCACAACAAAATA 1 179 1 GACATGTTCA 0.919269 -55 TTTGCTATTATAAAGGATCATATTTTGTTG 1 199 0 TAAAGGATCA 0.867247 -35 TCATCTATCAGCCAGATTCAATAGGGACAG 2 11 0 GCCAGATTCA 0.980182 -138 CCGGCGAAACGCCGGGGTCATTTCTCAATT 2 40 0 GCCGGGGTCA 0.97493 -109 CTTTTCAGAGGCAAGATTCACATTTTCCGC 3 158 1 GCAAGATTCA 0.930996 -69 CCTACAAGAATACAGGATCAAGCGGAAAAT 3 179 0 TACAGGATCA 0.959916 -48 ********** Masking position 10 Map Score: 2.25223 Number of sites scoring better than the average of aligned sites = 1035 Number in coding regions = 977 Number in noncoding regions = 58 Number of orfs with sites within 600 bp upstream = 51 Fraction of orfs with sites within 600 bp upstream = 0.00819146 Motif number 5 CCCCGGCGAAACGCCGGGGTCATTTCTCAA 2 42 0 ACGCCGGGGT 0.613412 -107 CCCCGGCGTTTCGCCGGGGTTTTGTGCTGC 2 53 1 TCGCCGGGGT 0.878981 -96 ATGAAGGAAATATACGGGGTGTACTAAAAT 3 40 0 TATACGGGGT 0.965213 -187 ********** Masking position 10 Map Score: 1.14039 Number of sites scoring better than the average of aligned sites = 25 Number in coding regions = 21 Number in noncoding regions = 4 Number of orfs with sites within 600 bp upstream = 2 Fraction of orfs with sites within 600 bp upstream = 0.000321234 Motif number 6 ********** No masking Map Score: 1.40931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 1.40931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 8 ********** No masking Map Score: 1.40931e-12 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0