AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i312_mixed26_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 yabF 144 similar to hypothetical proteins Motif number 1 TTTTGCGCCCTCTGTTTTTTTCGTTATAAT 1 34 1 TCTGTTTTTT 0.984909 -111 GAAAATGCACTTTGTCTATTATAACGAAAA 1 51 0 TTTGTCTATT 0.991855 -94 AAGTGCATTTTCTGCTTATTAGACGCTCGA 1 69 1 TCTGCTTATT 0.959782 -76 TTCATGAAACTTTTTCTTATATCGAGCGTC 1 90 0 TTTTTCTTAT 0.910324 -55 AATAAAAACTTTTGTATATTCATGAAACTT 1 108 0 TTTGTATATT 0.98745 -37 TATACAAAAGTTTTTATTTTGTCTTGGAGG 1 120 1 TTTTTATTTT 0.96377 -25 ********** Masking position 7 Map Score: 7.88367 Number of sites scoring better than the average of aligned sites = 955 Number in coding regions = 758 Number in noncoding regions = 197 Number of orfs with sites within 600 bp upstream = 201 Fraction of orfs with sites within 600 bp upstream = 0.032284 Motif number 2 CCCTCTGAATACATAAGTATATA 1 4 0 ACATAAGTAT 0.981769 -141 CTCGATATAAGAAAAAGTTTCATGAATATA 1 94 1 GAAAAAGTTT 0.980731 -51 TCATGAATATACAAAAGTTTTTATTTTGTC 1 113 1 ACAAAAGTTT 0.99353 -32 ********** Masking position 5 Map Score: 1.55695 Number of sites scoring better than the average of aligned sites = 65 Number in coding regions = 43 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 25 Fraction of orfs with sites within 600 bp upstream = 0.00401542 Motif number 3 ACTTATGTATTCAGAGGGTTTTGCGCCCTC 1 16 1 TCAGAGGGTT 0.98852 -129 AACGAAAAAAACAGAGGGCGCAAAACCCTC 1 29 0 ACAGAGGGCG 0.998374 -116 GTTATAATAGACAAAGTGCATTTTCTGCTT 1 56 1 ACAAAGTGCA 0.982349 -89 ********** Masking position 5 Map Score: 0.553614 Number of sites scoring better than the average of aligned sites = 152 Number in coding regions = 130 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 10 Fraction of orfs with sites within 600 bp upstream = 0.00160617 Motif number 4 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.53887e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0