AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i315_mixed29_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 pksG 224 pksG Motif number 1 TCAAGGTATGCCGTTCCGCCAAAGACATTC 1 37 0 CCGTTCCGCC 0.994727 -188 GAACGGCATACCTTGATGTCATGGAGCTGG 1 51 1 CCTTGATGTC 0.962662 -174 CTTCATAAGGCAGTGCTACCGCTTTTTCTT 1 129 0 CAGTGCTACC 0.958967 -96 TATGAAGATCCCGTGACTTCGGAGTCAATG 1 152 1 CCGTGACTTC 0.995242 -73 GGCTTAGCTGCATTGACTCCGAAGTCACGG 1 162 0 CATTGACTCC 0.974062 -63 TTCAATCCGGTCCTTCTCTGCTTCAG 1 209 0 CCGGTCCTTC 0.975974 -16 ********** Masking position 1 Map Score: 5.42624 Number of sites scoring better than the average of aligned sites = 923 Number in coding regions = 863 Number in noncoding regions = 60 Number of orfs with sites within 600 bp upstream = 52 Fraction of orfs with sites within 600 bp upstream = 0.00835207 Motif number 2 ATGGTTTCAGCCGGAATAGAAG 1 2 1 TGTTTCAGCC 0.982419 -223 AAGCGATGAATGTCTTTGGCGGAACGGCATA 1 30 1 TGCTTTGGCG 0.997376 -195 TCTAAGTGTCTGTATTTGGCCAGCTCCATGA 1 69 0 TGATTTGGCC 0.993079 -156 GAAGATCCCGTGACTTCGGAGTCAATGCAGC 1 155 1 TGCTTCGGAG 0.993481 -70 ** ******** Masking position 6 Map Score: 2.17606 Number of sites scoring better than the average of aligned sites = 215 Number in coding regions = 199 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 3 TTTCAAATCTCGCAGTATCTAAGTGTCTGT 1 87 0 CGCAGTATCT 0.98945 -138 GCAGTGCTACCGCTTTTTCTTTCATTAATA 1 120 0 CGCTTTTTCT 0.98908 -105 TCGGCTTAGCTGCATTGACTCCGAAGTCAC 1 164 0 TGCATTGACT 0.971779 -61 CGATTATTGATGCTTTATCTGAAGCAGAGA 1 191 1 TGCTTTATCT 0.990405 -34 ********** Masking position 6 Map Score: 2.79639 Number of sites scoring better than the average of aligned sites = 219 Number in coding regions = 197 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 21 Fraction of orfs with sites within 600 bp upstream = 0.00337295 Motif number 4 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.34864e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0