AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i339_weak10_bsub_reg_100.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ykrW 196 similar to ribulose-bisphosphate carboxylase Motif number 1 TCTTATCAAGAGCAGGCAGAGGGACGAGCCCG 1 50 1 AGCAGGAGAG 0.995969 -147 CAGAGGGACGAGCCCGATGAAGCCCGGCAACC 1 66 1 AGCCCGTGAG 0.997367 -131 GTGCTTTATAAGTCGGTTGCCGGGCTTCATCG 1 80 0 AGTCGGTGCG 0.994352 -117 CGACTTATAAAGCACGGTGCTAATTCTTGCAG 1 97 1 AGCACGTGCA 0.983225 -100 CTTATCTCTCAGCCGCTAGCTGCAAGAATTAG 1 116 0 AGCCGCAGCG 0.994269 -81 TAGACGCGATTGCAGTTTGAAGAGGTTTTTTG 1 173 1 TGCAGTTGAG 0.956126 -24 ****** *** * Masking position 9 Map Score: 6.79381 Number of sites scoring better than the average of aligned sites = 1188 Number in coding regions = 1120 Number in noncoding regions = 68 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 CGATGGGATAATTCAAAATAA 1 2 1 GATGGGATAA 0.977756 -195 GCCTGCTCTTGATAAGAAAATATAGATTTT 1 37 0 GATAAGAAAA 0.958688 -160 GCGGCTGAGAGATAAGATTCGGACGAGAAA 1 132 1 GATAAGATTC 0.972519 -65 ATAAGATTCGGACGAGAAACGAAACCTCTT 1 143 1 GACGAGAAAC 0.988646 -54 AACCTCTTTAGACGCGATTGCAGTTTGAAG 1 165 1 GACGCGATTG 0.965268 -32 ********** Masking position 7 Map Score: 1.64215 Number of sites scoring better than the average of aligned sites = 521 Number in coding regions = 469 Number in noncoding regions = 52 Number of orfs with sites within 600 bp upstream = 40 Fraction of orfs with sites within 600 bp upstream = 0.00642467 Motif number 3 GACGAGAAACGAAACCTCTTTAGACGCGAT 1 153 1 GAAACCTCTT 0.994396 -44 ATCAAAAAACCTCTTCAAACTGCAA 1 182 0 AAAACCTCTT 0.976155 -15 ********** Masking position 4 Map Score: 1.032 Number of sites scoring better than the average of aligned sites = 14 Number in coding regions = 12 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 1 Fraction of orfs with sites within 600 bp upstream = 0.000160617 Motif number 4 CTCTGCCTGCTCTTGATAAGAAAATATAGA 1 41 0 TCTTGATAAG 0.989879 -156 TTAGCACCGTGCTTTATAAGTCGGTTGCCG 1 90 0 GCTTTATAAG 0.989795 -107 AAACGAAACCTCTTTAGACGCGATTGCAGT 1 159 1 TCTTTAGACG 0.9879 -38 ********** Masking position 6 Map Score: 0.960805 Number of sites scoring better than the average of aligned sites = 110 Number in coding regions = 94 Number in noncoding regions = 16 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 5 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 3.50598e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0