AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i341_weak2_bsub_reg_300.orf -aORF_bsub.txt -zbsub.fna -g0.435 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.435 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 ykpA 180 similar to ABC transporter (ATP-binding protein) Motif number 1 TACACACTCTCATGGAGGAACACG 1 5 0 CATGGAGGAA 0.988913 -176 AATGCATCCGCCTGGAAAATTACACACTCT 1 25 0 CCTGGAAAAT 0.932429 -156 TACAATTAAAGAGAGAGAATGCATCCGCCT 1 42 0 GAGAGAGAAT 0.986643 -139 CCTGATAAAACAGAGAGAAAACACTTATAC 1 93 0 CAGAGAGAAA 0.986643 -88 TGAATGCAGGGCAAGAGAAATGATTCCCTG 1 119 0 GCAAGAGAAA 0.957357 -62 TGATAGACATGATGGAGGATAATAA 1 166 1 GATGGAGGAT 0.988913 -15 ********** Masking position 6 Map Score: 6.55828 Number of sites scoring better than the average of aligned sites = 980 Number in coding regions = 847 Number in noncoding regions = 133 Number of orfs with sites within 600 bp upstream = 146 Fraction of orfs with sites within 600 bp upstream = 0.02345 Motif number 2 CGTGTTCCTCCATGAGAGTGTGTAATTTT 1 10 1 CCATGAGAGT 0.991819 -171 AGCTGTGTTACAATTAAAGAGAGAGAATGC 1 50 0 CAATTAAAGA 0.964954 -131 TAAAAGTATACCATGAATGCAGGGCAAGAG 1 132 0 CCATGAATGC 0.973072 -49 TGTCTATCATCAATAAAAGTATACCATGAA 1 145 0 CAATAAAAGT 0.980115 -36 ********** Masking position 6 Map Score: 1.42485 Number of sites scoring better than the average of aligned sites = 202 Number in coding regions = 168 Number in noncoding regions = 34 Number of orfs with sites within 600 bp upstream = 23 Fraction of orfs with sites within 600 bp upstream = 0.00369419 Motif number 3 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0