AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i066_Lysine_Biosynthesis_ctra_reg_100.orf -o066_ctra_100.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00412 49 Chlamydia_trachomatis #2 RCT00414 300 Chlamydia_trachomatis Motif number 1 CCAAAATGAAACTGTTTCCTGCTCCAGAAT 1 22 0 ACTGTTTCCT 0.93538 -28 CGATTCTCCCAAAATGAAAC 1 40 0 CGATTCTCCC 0.867679 -10 AAGCTTTTTTCCTAGTAGGAAGC 2 4 1 CTTTTTTCCT 0.953433 -297 ACCAAGCGCCCCATTTTCCCTAGTCGCTTA 2 98 0 CCATTTTCCC 0.970422 -203 AAGCATCGTTTCTTTTTCTTATAGTTATAG 2 139 1 TCTTTTTCTT 0.908368 -162 AAATAAATCCTCTTTCTCCTAGAAAGTTTA 2 172 1 TCTTTCTCCT 0.990758 -129 GAAAGTTTAGACTTTCTCATCAAAAGATTA 2 193 1 ACTTTCTCAT 0.893099 -108 TACCCACTCTCCCTTATCCTTTATGGGAAT 2 224 0 CCCTTATCCT 0.967986 -77 GCAGAGGCACTCTTTATCCTCTACCCACTC 2 245 0 TCTTTATCCT 0.979415 -56 ********** Masking position 5 Map Score: 9.28925 Number of sites scoring better than the average of aligned sites = 492 Number in coding regions = 490 Number in noncoding regions = 2 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 ATGAAACTGTTTCCTGCTCCAGAATATAAA 1 17 0 TTCCTGCTCC 0.985364 -33 TTTAATACCATTGCAGCTTCAGTTGATCAT 2 57 0 TTGCAGCTTC 0.966648 -244 TGCAATGGTATTAAAGCACCTTATGGTAAG 2 72 1 TTAAAGCACC 0.913985 -229 GAAACGATGCTTCCAAGACCATTACCAAGC 2 121 0 TTCCAAGACC 0.984449 -180 TGATTAAACCTTGCAAGACCTTGCAGAGGC 2 267 0 TTGCAAGACC 0.977508 -34 ATTTCCACCTCCACTGATTAAA 2 289 0 TTCCACCTCC 0.990272 -12 ********** Masking position 2 Map Score: 4.9779 Number of sites scoring better than the average of aligned sites = 163 Number in coding regions = 162 Number in noncoding regions = 1 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 CGATTCTCCCAAAATGAAACTGTTTC 1 34 0 TCCCAAAATG 0.978453 -16 AAGCTTTTTTCCTAGTAGGAAGCTTCTTG 2 10 1 TCCTAGTAGG 0.978526 -291 CCTAGTCGCTTACCATAAGGTGCTTTAATA 2 80 0 TACCATAAGG 0.976654 -221 ATCCTCTTTCTCCTAGAAAGTTTAGACTTT 2 178 1 TCCTAGAAAG 0.989789 -123 AAGATTAGATTCCCATAAAGGATAAGGGAG 2 216 1 TCCCATAAAG 0.992966 -85 ********** Masking position 5 Map Score: 4.81128 Number of sites scoring better than the average of aligned sites = 78 Number in coding regions = 78 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 GTAGGAAGCTTCTTGACTTTTGCTGTAAGA 2 25 1 TCTTGACTTT 0.978642 -276 AGAGGATTTATTTTAACTATAACTATAAGA 2 155 0 TTTTAACTAT 0.886123 -146 GATGAGAAAGTCTAAACTTTCTAGGAGAAA 2 184 0 TCTAAACTTT 0.98736 -117 TTTATGGGAATCTAATCTTTTGATGAGAAA 2 205 0 TCTAATCTTT 0.968668 -96 ********** Masking position 3 Map Score: 1.46044 Number of sites scoring better than the average of aligned sites = 43 Number in coding regions = 43 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0