AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i205_dna_mismatch_repair_ctra_reg_300.orf -o205_ctra_300.ace -a/home/amcguire/alignace/lib/ORF_ctra.txt -z/skink1/amcguire/genomes/ctra.fna -g0.41 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.41 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCT00758 300 Chlamydia_trachomatis Motif number 1 ATCGTACAATATTTTTTTTACACGCGATGCCCGCTCTT 1 41 1 ATTTTTAGGT 0.964316 -260 ATGGCGGATCCTTTATCGCCGAAGAGCGGGCATCGCGT 1 62 0 CTTTATAGGG 0.967263 -239 CGCACTATAATTTTCTTGGGAATGTGTGCTTCTTTCTC 1 105 1 TTTTCTAGGG 0.989845 -196 ATGTGTGCTTCTTTCTCCCTGATGGATTCCTTTTTCTC 1 126 1 CTTTCTAGAT 0.978916 -175 TGATGGATTCCTTTTTCTCTTAAGAATTTTGCTTCCCA 1 145 1 CTTTTTAGAT 0.969846 -156 ACGGTGTTGAATTTTTGGGGAATACAAGACTTTGGGAA 1 177 0 ATTTTTAAAG 0.890426 -124 GTTTCGAAGGTTTTCTGATACATAAGAGCCTGTTCCCC 1 226 1 TTTTCTAAGG 0.950363 -75 ATCGAAAAAATTTTTTATTCGTAGTAGGGGAACAGGCT 1 252 0 TTTTTTTGAG 0.924027 -49 GAATAAAAAATTTTTTCGATCACGCAATACTAGATAAA 1 270 1 TTTTTTAGAT 0.975192 -31 ****** * * * * Masking position 6 Map Score: 6.28938 Number of sites scoring better than the average of aligned sites = 332 Number in coding regions = 332 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 2 ATTTTTTTTACACGCGATGCCCGCTCTTCGGC 1 51 1 CCGCGATCCC 0.996097 -250 AGAAAATTATAGTGCGTTACCATGGCGGATCC 1 89 0 ATGCGTTCCA 0.973086 -212 GAGAAAGAAGCACACATTCCCAAGAAAATTAT 1 111 0 CCACATTCCA 0.973256 -190 TTCCCAAAGTCTTGTATTCCCCAAAAATTCAA 1 177 1 CTGTATTCCC 0.954832 -124 CCGTTGTACACTCGCGTTTCGAAGGTTTTCTG 1 211 1 CCGCGTTCGA 0.991103 -90 GATACATAAGAGCCTGTTCCCCTACTACGAAT 1 242 1 ACCTGTTCCC 0.909181 -59 TTTTTTCGATCACGCAATACTAGATAAAGCT 1 280 1 CCGCAATCTA 0.940587 -21 * ****** *** Masking position 8 Map Score: 3.66561 Number of sites scoring better than the average of aligned sites = 147 Number in coding regions = 147 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 3 GCGATAAAGGATCCGCCATGGTAACGCACTA 1 81 1 ATCGCCATGG 0.966267 -220 AGAAAAAGGAATCCATCAGGGAGAAAGAAGC 1 132 0 ATCATCAGGG 0.989323 -169 GGGAAGCAAAATTCTTAAGAGAAAAAGGAAT 1 151 0 ATCTTAAGAG 0.978301 -150 AGGTTTTCTGATACATAAGAGCCTGTTCCCC 1 233 1 ATCATAAGAG 0.987577 -68 AAAATTTTTTATTCGTAGTAGGGGAACAGGC 1 253 0 ATCGTAGTAG 0.960737 -48 ** ******** Masking position 2 Map Score: 0.8547 Number of sites scoring better than the average of aligned sites = 50 Number in coding regions = 50 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0