AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i021_Succinyl-CoA_Synthetase_synecho_reg_100.orf -o021_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY10148 16 Synechocystis #2 RCY23515 146 Synechocystis #3 RCY51144 104 Synechocystis Motif number 1 CGGGGATCAACGGCGATCGCTA 2 3 1 GGGATCAACG 0.992249 -144 TTTGGTGATGGGGGTCTACCCCCCTATCAG 2 33 0 GGGGTCTACC 0.996288 -114 TATCTCTGCAGGCCTCCACCTTCCCCT 2 130 1 GGCCTCCACC 0.994897 -17 GCTTCACTGTATCGTCAACCAGAGCAAAAT 3 16 0 ATCGTCAACC 0.967866 -89 CGCAGCTATCGGGGTCAACCAGTCCAAGCT 3 43 0 GGGGTCAACC 0.999057 -62 TGCGGAGTAGGGCATCAAGCCACAGTTTTC 3 69 1 GGCATCAAGC 0.992249 -36 ********** Masking position 5 Map Score: 11.36 Number of sites scoring better than the average of aligned sites = 366 Number in coding regions = 323 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 2 GGGGTCTACCCCCCTATCAGTAGCGATCGCC 2 22 0 CCCCTTCAGT 0.956637 -125 GGGGGGTAGACCCCCATCACCAAAGCCCCCA 2 39 1 CCCCCTCACC 0.995599 -108 TCCAGTCATACCATCTTCCCTCATTATTGGG 2 66 0 CCATCTCCCT 0.980906 -81 CCGGAAAAACCAGGACTCAGCAAGGTTTAGT 2 97 0 CAGGATCAGC 0.899822 -50 CTGCAGGCCTCCACCTTCCCCT 2 135 1 CCACCTCCCC 0.994583 -12 TCAACCAGTCCAAGCTTCACTGTATCGTCAA 3 28 0 CAAGCTCACT 0.978796 -77 TGGCTTGATGCCCTACTCCGCAGCTATCGGG 3 60 0 CCCTATCCGC 0.964053 -45 AGTAGGGCATCAAGCCACAGTTTTCCTTTAA 3 74 1 CAAGCACAGT 0.892151 -31 ***** ***** Masking position 8 Map Score: 6.41117 Number of sites scoring better than the average of aligned sites = 3443 Number in coding regions = 3214 Number in noncoding regions = 229 Number of orfs with sites within 600 bp upstream = 224 Fraction of orfs with sites within 600 bp upstream = 0.0359782 Motif number 3 ATTTTAGAGATCACTT 1 4 1 TTAGAGATCA 0.942135 -13 CCCCCTATCAGTAGCGATCGCCGTTGATCC 2 14 0 GTAGCGATCG 0.997365 -133 GTGGAGGCCTGCAGAGATAGACCGGAAAAA 2 119 0 GCAGAGATAG 0.990155 -28 GCCCTACTCCGCAGCTATCGGGGTCAACCA 3 52 0 GCAGCTATCG 0.993634 -53 ********** Masking position 7 Map Score: 3.14447 Number of sites scoring better than the average of aligned sites = 711 Number in coding regions = 674 Number in noncoding regions = 37 Number of orfs with sites within 600 bp upstream = 46 Fraction of orfs with sites within 600 bp upstream = 0.00738837 Motif number 4 TAGACCGGAAAAACCAGGACTCAGCAAGGT 2 102 0 AAACCAGGAC 0.990524 -45 ACTGTATCGTCAACCAGAGCAAAATGTCCC 3 11 0 CAACCAGAGC 0.996498 -94 CTATCGGGGTCAACCAGTCCAAGCTTCACT 3 38 0 CAACCAGTCC 0.996386 -67 ********** Masking position 6 Map Score: 1.37304 Number of sites scoring better than the average of aligned sites = 95 Number in coding regions = 84 Number in noncoding regions = 11 Number of orfs with sites within 600 bp upstream = 13 Fraction of orfs with sites within 600 bp upstream = 0.00208802 Motif number 5 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.23894e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0