AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i050_Gluthatione-dependent_hydrolases_synecho_reg_300.orf -o050_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY34376 300 Synechocystis Motif number 1 AATGACCGTTGCCAAAAAGGAACGGGGTAATGATG 1 16 1 GCCAAGGAAG 0.989231 -285 TCGGGACTGGGCAAAAGAGCAACAGATGGGGGCTT 1 56 0 GCAAAGCAAG 0.977705 -245 CTGTTGACAGTGCACATCGGGACTGGGCAAAAGAG 1 72 0 TGCAAGGGAG 0.986535 -229 GAATATTTCCGGGGGACAGGGAAAGGATAGTTGAC 1 115 0 GGGGAGGGAG 0.990092 -186 CAAAAAATATGGGAGAATGGAATTGAGTAGCAAGC 1 173 1 GGGAAGGAAG 0.995427 -128 GAATTGAGTAGCAAGCCTGGGTGCGTAGCTCAGTG 1 192 1 GCAACGGGTG 0.975907 -109 CGTAGCTCAGTGGATAGAGCATCCGCCTTCTAAGC 1 215 1 TGGAAGCATG 0.950707 -86 GCGGCAGGATTCGAACCTGCGACCGTCCGCTTAGA 1 243 0 TCGACGCGAG 0.966103 -58 AACGTTGAAGGGAATAACGGGTGCGGCAGGATTCG 1 265 0 GGAAAGGGTG 0.990867 -36 **** * **** * Masking position 9 Map Score: 11.2897 Number of sites scoring better than the average of aligned sites = 1326 Number in coding regions = 1177 Number in noncoding regions = 149 Number of orfs with sites within 600 bp upstream = 154 Fraction of orfs with sites within 600 bp upstream = 0.024735 Motif number 2 CGTTCCTTTTTGGCAACGGTCATTTGGGT 1 9 0 TGGCAACGGC 0.994751 -292 GGGGTAATGATGTCAGCAAGCCCCCATCTGT 1 39 1 TGTCAGCAAC 0.992382 -262 CGATGTGCACTGTCAACAGCCGTAGCTGTCA 1 88 1 TGTCAACAGC 0.996336 -213 CAGCCGTAGCTGTCAACTATCCTTTCCCTGT 1 104 1 TGTCAACTAC 0.9856 -197 GCATCCGCCTTCTAAGCGGACGGTCGCAGGT 1 233 1 TCTAAGCGGC 0.96111 -68 ********* * Masking position 5 Map Score: 3.95274 Number of sites scoring better than the average of aligned sites = 179 Number in coding regions = 159 Number in noncoding regions = 20 Number of orfs with sites within 600 bp upstream = 22 Fraction of orfs with sites within 600 bp upstream = 0.00353357 Motif number 3 TGCCAAAAAGGAACGGGGTAATGATGTCAG 1 25 1 GAACGGGGTA 0.990138 -276 ATTTCGGTGTTAATGGAATATTTCCGGGGG 1 135 0 TAATGGAATA 0.969954 -166 TGGGAGAATGGAATTGAGTAGCAAGCCTGG 1 182 1 GAATTGAGTA 0.980861 -119 CCTTAACGTTGAAGGGAATAACGGGTGCGG 1 274 0 GAAGGGAATA 0.991066 -27 ********** Masking position 3 Map Score: 1.20485 Number of sites scoring better than the average of aligned sites = 126 Number in coding regions = 116 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 11 Fraction of orfs with sites within 600 bp upstream = 0.00176678 Motif number 4 AAAGGAACGGGGTAATGATGTCAGCAAGCCC 1 31 1 GGTAATGATT 0.983232 -270 CGGGGGACAGGGAAAGGATAGTTGACAGCTA 1 110 0 GGAAAGGATG 0.98726 -191 TATTTTTTGGGGCTAGGATTTCGGTGTTAAT 1 151 0 GGCTAGGATT 0.98726 -150 TCCCTTCAACGTTAAGGATCTGCT 1 287 1 GTTAAGGATT 0.983232 -14 ********* * Masking position 5 Map Score: 0.477858 Number of sites scoring better than the average of aligned sites = 158 Number in coding regions = 128 Number in noncoding regions = 30 Number of orfs with sites within 600 bp upstream = 31 Fraction of orfs with sites within 600 bp upstream = 0.00497912 Motif number 5 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: 7.91135e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0