AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i068_Proline_Biosynthesis_synecho_reg_100.orf -o068_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY53629 161 Synechocystis #2 RCY42873 96 Synechocystis #3 RCY48238 125 Synechocystis Motif number 1 TCCACCGGTTGGCGGTTTGGGTTTGAATTT 1 28 0 GGCGGTTTGG 0.986595 -134 ACCGCCAACCGGTGGAATTGAACCGCACTT 1 42 1 GGTGGAATTG 0.977264 -120 GTCTATTGTTGGTGGCTGTGTTGGGGATTT 1 84 1 GGTGGCTGTG 0.962341 -78 TGGCTGTGTTGGGGATTTTGTTCTCCAGCT 1 96 1 GGGGATTTTG 0.964653 -66 ACGCAATTTAGGAGGCATGGT 1 151 1 GGAGGCATGG 0.991326 -11 TGGTTTTAAGGTGGGCTTGGCCCACTTTTT 2 38 1 GTGGGCTTGG 0.96885 -59 TATTTTGGGAGGAAAAATTGCCATAAAAAA 2 64 0 GGAAAAATTG 0.735028 -33 GCTTGAACCTGGGGGAATGGCT 3 3 0 GGGGGAATGG 0.992044 -123 TTTCGGACAGGGCAACTTTGGGGGGCAAAC 3 70 0 GGCAACTTTG 0.916095 -56 ********** Masking position 1 Map Score: 11.9483 Number of sites scoring better than the average of aligned sites = 3935 Number in coding regions = 3625 Number in noncoding regions = 310 Number of orfs with sites within 600 bp upstream = 290 Fraction of orfs with sites within 600 bp upstream = 0.0465789 Motif number 2 TTGGCGGTTTGGGTTTGAATTTCTGTCCATG 1 19 0 GGGTTTGATT 0.913098 -143 GCCAACCGGTGGAATTGAACCGCACTTCTTT 1 45 1 GGAATTGACC 0.9114 -117 TCGAGGGCTAGCCGCCACACAATAT 2 5 1 GGGCTAGCGC 0.991983 -92 GTTTTAAGGTGGGCTTGGCCCACTTTTTTTA 2 40 1 GGGCTTGCCC 0.80435 -57 AAAATATTTACGGCTTGAACCTGGGGGAATG 3 14 0 CGGCTTGACC 0.992333 -112 CTGCGCTTTGCTGTTTGCCCCCCAAAGTTGC 3 58 1 CTGTTTGCCC 0.957818 -68 GGGTTAGACGTTGACGATGCA 3 115 0 GGGTTAGCGT 0.962117 -11 ******* *** Masking position 5 Map Score: 5.7957 Number of sites scoring better than the average of aligned sites = 1453 Number in coding regions = 1318 Number in noncoding regions = 135 Number of orfs with sites within 600 bp upstream = 151 Fraction of orfs with sites within 600 bp upstream = 0.0242531 Motif number 3 AGACCCAGGTATAAAGAAGTGCGGTTCAAT 1 58 0 ATAAAGAAGT 0.958228 -104 AAAAGTTTAGTTAAAGAAATAGCTGGAGAA 1 116 0 TTAAAGAAAT 0.971012 -46 AAATTGCGTATTAAAAAAGTTTAGTTAAAG 1 130 0 TTAAAAAAGT 0.985899 -32 AAAATTGCCATAAAAAAAGTGGGCCAAGCC 2 51 0 TAAAAAAAGT 0.955057 -46 GGGAAAGTATTTAAAAATATTTACGGCTTG 3 28 0 TTAAAAATAT 0.904133 -98 ********** Masking position 5 Map Score: 4.23307 Number of sites scoring better than the average of aligned sites = 102 Number in coding regions = 83 Number in noncoding regions = 19 Number of orfs with sites within 600 bp upstream = 24 Fraction of orfs with sites within 600 bp upstream = 0.0038548 Motif number 4 ********** No masking Map Score: 2.44017e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.44017e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.44017e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0