AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i101_Iron_Transport_synecho_reg_100.orf -o101_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY33239 167 Synechocystis #2 RCY02899 51 Synechocystis #3 RCY35187 264 Synechocystis Motif number 1 CCCTGCCTTGTCCATGGCGATCGCTGTTTAT 1 13 0 TCCATGGCGT 0.951707 -155 GGGAACTATTCCGGTTGCCCCCTTTTATTGA 1 41 1 CCGGTTGCCC 0.932339 -127 AACCTAATTGCCCGACTCCGTTCTTTACTTT 1 95 0 CCCGACTCCT 0.935019 -73 TACCTAAAGATCCGTGCCCTTTCTCCAATGC 1 132 1 TCCGTGCCCT 0.947399 -36 CCAAAGACAACCCAAGGCCATTCCAGGCTAA 2 31 1 CCCAAGGCCT 0.994232 -21 CCCCATGACCTCATTTACTTGT 3 2 1 CCCATGACCC 0.987814 -263 AGGAAGAATCCCCATGGCGACCAAGCATTTA 3 150 1 CCCATGGCGC 0.992299 -115 GGCATTAAAACCCATTTCCCTGTCCCCCAGT 3 195 1 CCCATTTCCT 0.973253 -70 TTTCCCTGTCCCCCAGTCCTCTACAATAATC 3 209 1 CCCCAGTCCC 0.975176 -56 ********* * Masking position 8 Map Score: 9.63758 Number of sites scoring better than the average of aligned sites = 2610 Number in coding regions = 2370 Number in noncoding regions = 240 Number of orfs with sites within 600 bp upstream = 241 Fraction of orfs with sites within 600 bp upstream = 0.0387086 Motif number 2 ACAAGGCAGGGAACTATTCCGGTTGCCCCCT 1 33 1 GAACATTCCG 0.966482 -135 GAACGGAGTCGGGCAATTAGGTTAATCCCTA 1 103 1 GGGCATTAGG 0.990779 -65 GAAAGGGCACGGATCTTTAGGTAGGGATTAA 1 124 0 GGATTTTAGG 0.96078 -44 CTTTGGAGTTGACCCGTTAGGTTTGA 2 6 0 GACCGTTAGG 0.968537 -46 TAATTGTTAAGAATAATTAGGAATAGTAAGA 3 89 0 GAATATTAGG 0.980864 -176 ATTTAACAGAGGACTATTCGGCATTAAAACC 3 176 1 GGACATTCGG 0.994968 -89 **** ****** Masking position 7 Map Score: 3.61534 Number of sites scoring better than the average of aligned sites = 160 Number in coding regions = 137 Number in noncoding regions = 23 Number of orfs with sites within 600 bp upstream = 29 Fraction of orfs with sites within 600 bp upstream = 0.00465789 Motif number 3 GGCAATTAGGTTAATCCCTACCTAAAGATC 1 114 1 TTAATCCCTA 0.982261 -54 TTCTTAACAATTAATAGCCACTACAGCAAT 3 107 1 TTAATAGCCA 0.953803 -158 GGAAAAAGGAAGAATCCCCATGGCGACCAA 3 144 1 AGAATCCCCA 0.944638 -121 CTATTCGGCATTAAAACCCATTTCCCTGTC 3 189 1 TTAAAACCCA 0.931789 -76 GTCCTCTACAATAATCTCTAATCTTATTAG 3 224 1 ATAATCTCTA 0.881932 -41 GTAGTTAATCTTAATAACTATG 3 253 1 TTAATAACTA 0.898612 -12 ********** Masking position 4 Map Score: 1.70606 Number of sites scoring better than the average of aligned sites = 580 Number in coding regions = 508 Number in noncoding regions = 72 Number of orfs with sites within 600 bp upstream = 88 Fraction of orfs with sites within 600 bp upstream = 0.0141343 Motif number 4 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -5.51791e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0