AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i105_Manganese_Transport_synecho_reg_100.orf -o105_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY20071 98 Synechocystis #2 RCY34291 164 Synechocystis Motif number 1 AAACAACTTTGTGTTTTGACACGTTGA 1 6 1 ACTTGGTTTT 0.970815 -93 GTGTTTTGACACGTTGAGTTTTTCTGTAATCA 1 21 1 ACTTGGTTTT 0.970815 -78 CTGGACTTAATCTTGACGATTTACCACTACCT 1 54 1 TCTGAGATTT 0.970811 -45 ACTGGTAAGCTCGTGGGCTTTTTCTGA 2 6 0 TCTGGCTTTT 0.991822 -159 GAGTTAAAATTTCTTAACTTTTACCAACTGGT 2 32 0 TTTTACTTTT 0.915167 -133 ATCTCATTTTTCATTATCTTCTCATAATTGCA 2 75 0 TCTTACTTCT 0.982443 -90 TAATGGTCTTTCATGATCATCTCATTTTTCAT 2 93 0 TCTGACATCT 0.965713 -72 ** *** ***** Masking position 4 Map Score: 5.94677 Number of sites scoring better than the average of aligned sites = 447 Number in coding regions = 381 Number in noncoding regions = 66 Number of orfs with sites within 600 bp upstream = 73 Fraction of orfs with sites within 600 bp upstream = 0.011725 Motif number 2 TCTTGACGATTTACCACTACCTAAAATCTG 1 64 1 TTACCACTAC 0.982179 -35 AGTTAAGAAATTTTAACTCCCCGTTTTCAC 2 45 1 TTTTAACTCC 0.951711 -120 TAACTCCCCGTTTTCACTGCAATTATGAGA 2 58 1 TTTTCACTGC 0.990371 -107 ATCATCTCATTTTTCATTATCTTCTCATAA 2 80 0 TTTTCATTAT 0.937154 -85 TGAAAGACCATTATCACTATGGCAACATCA 2 112 1 TTATCACTAT 0.981916 -53 ********** Masking position 6 Map Score: 3.33548 Number of sites scoring better than the average of aligned sites = 261 Number in coding regions = 223 Number in noncoding regions = 38 Number of orfs with sites within 600 bp upstream = 45 Fraction of orfs with sites within 600 bp upstream = 0.00722775 Motif number 3 CAAGATTAAGTCCAGTTGATTACAGAAAAA 1 39 0 TCCAGTTGAT 0.926867 -60 CCACGAGCTTACCAGTTGGTAAAAGTTAAG 2 22 1 ACCAGTTGGT 0.62181 -143 CACTGCAATTATGAGAAGATAATGAAAAAT 2 72 1 ATGAGAAGAT 0.958341 -93 ATAATGAAAAATGAGATGATCATGAAAGAC 2 90 1 ATGAGATGAT 0.97052 -75 CTCCCCGGGAAGCAAATGATGTTGCCATAG 2 128 0 AGCAAATGAT 0.788398 -37 ********** Masking position 4 Map Score: 1.3844 Number of sites scoring better than the average of aligned sites = 337 Number in coding regions = 292 Number in noncoding regions = 45 Number of orfs with sites within 600 bp upstream = 48 Fraction of orfs with sites within 600 bp upstream = 0.0077096 Motif number 4 AGTTGATTACAGAAAAACTCAACGTGTCAA 1 26 0 AGAAAAACTC 0.987438 -73 TAAATCGTCAAGATTAAGTCCAGTTGATTA 1 47 0 AGATTAAGTC 0.978855 -52 TCAGAAAAAGCCCACGAGCTTA 2 3 1 AGAAAAAGCC 0.991827 -162 ********** Masking position 6 Map Score: 0.523319 Number of sites scoring better than the average of aligned sites = 71 Number in coding regions = 61 Number in noncoding regions = 10 Number of orfs with sites within 600 bp upstream = 14 Fraction of orfs with sites within 600 bp upstream = 0.00224863 Motif number 5 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -1.75204e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0