AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i107_TRK_operon_synecho_reg_100.orf -o107_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY20248 131 Synechocystis Motif number 1 GTTGCTTACTCAACCCTCAAATTTCCCCAT 1 33 1 CAACCCTCAA 0.986518 -99 CCCTCAAATTTCCCCATCAAACCTTGGTGG 1 46 1 TCCCCATCAA 0.998453 -86 TGGTGGCCAATCCCCACCAAGGTTTGATGG 1 59 0 TCCCCACCAA 0.996572 -73 TGGGGATTGGCCACCATCAATTTTCGTGAA 1 73 1 CCACCATCAA 0.998453 -59 TGAACTTCCATTACAATCAAGCCTGTTATC 1 99 1 TTACAATCAA 0.966476 -33 ********** Masking position 9 Map Score: 9.97918 Number of sites scoring better than the average of aligned sites = 689 Number in coding regions = 635 Number in noncoding regions = 54 Number of orfs with sites within 600 bp upstream = 56 Fraction of orfs with sites within 600 bp upstream = 0.00899454 Motif number 2 GGGTCTGTGGGCCAAAATTCTAGTT 1 6 1 TGTGGGCCAA 0.997242 -126 CACCAAGGTTTGATGGGGAAATTTGAGGGT 1 45 0 TGATGGGGAA 0.981492 -87 CGAAAATTGATGGTGGCCAATCCCCACCAA 1 69 0 TGGTGGCCAA 0.998005 -63 CAATCAAGCCTGTTATCCAACGGGTGAAAG 1 112 1 TGTTATCCAA 0.976812 -20 ********** Masking position 9 Map Score: 4.31733 Number of sites scoring better than the average of aligned sites = 742 Number in coding regions = 706 Number in noncoding regions = 36 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 8.05918e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0