AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i174_Biotin_Biosynthesis_synecho_reg_300.orf -o174_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY43755 46 Synechocystis #2 RCY14039 107 Synechocystis #3 RCY51943 111 Synechocystis Motif number 1 TCAAAAGTTCACCCAACATTCTACTAGGGG 1 6 0 ACCCACTCAT 0.99719 -41 ACGGGTTAAAATCCATCTACCCAATTGATCAAGTT 2 20 0 ATCCACCCAT 0.98438 -88 ATGGATTTTAACCCGTAGGCTCATTGGTCAGCTCA 2 39 1 ACCCGACTAT 0.930721 -69 GAATTACCCACCCCCCAATACAACAAAATA 2 88 0 ACCCACCCAA 0.995184 -20 CGATATACTGACCCCGCGTCCCCATTCCCA 3 6 0 ACCCCCCCCT 0.995074 -106 AGTCAACAAAACCCGATATTCTACTAAAAGACTAA 3 51 1 ACCCGTTCAT 0.968779 -61 AAAAGACTAAACACATCGTTTTCCAACGCTAGAGC 3 76 1 ACACACTTCA 0.795488 -36 TGGCCCACCCAGCTCTAGCGTTGGAAAACGA 3 91 0 ACCCACTACT 0.981387 -21 ***** * ** * * Masking position 1 Map Score: 7.0462 Number of sites scoring better than the average of aligned sites = 838 Number in coding regions = 756 Number in noncoding regions = 82 Number of orfs with sites within 600 bp upstream = 99 Fraction of orfs with sites within 600 bp upstream = 0.0159011 Motif number 2 CCCCTAGTAGAATGTTGGGTGAACTTTTG 1 4 1 CTGTAGTTGG 0.993155 -43 CTTAACTTGATCAATTGGGTAGATGGATTTTAACCC 2 17 1 TCATTGTGGG 0.980589 -91 TGGATTTTAACCCGTAGGCTCATTGGTCAGCTCAAG 2 40 1 CCGTAGTAGG 0.984092 -68 CTAATCGTATTTTGTTGTATTGGGGGGTGGGTAATT 2 81 1 TTGTTGTGGG 0.99747 -27 AATATCGGGTTTTGTTGACTAGGCGATCGCCGATAT 3 35 0 TTGTTGTGGA 0.983876 -77 GTTTAGTCTTTTAGTAGAATATCGGGTTTTGTTGAC 3 52 0 TTGTAGTTGG 0.994297 -60 ** **** * * ** Masking position 10 Map Score: 4.83946 Number of sites scoring better than the average of aligned sites = 311 Number in coding regions = 278 Number in noncoding regions = 33 Number of orfs with sites within 600 bp upstream = 36 Fraction of orfs with sites within 600 bp upstream = 0.0057822 Motif number 3 GCTGTGCTTAACTTGATCAATTGGG 2 6 1 GCTTAACTTG 0.974981 -102 GATTAGTAAAGCTTGAGCTGACCAATGAGC 2 57 0 GCTTGAGCTG 0.998129 -51 GTTTTCCAACGCTAGAGCTGGGTGGGCCA 3 93 1 GCTAGAGCTG 0.996706 -19 ********** Masking position 6 Map Score: 2.23043 Number of sites scoring better than the average of aligned sites = 51 Number in coding regions = 45 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 4 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.79544e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0