AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_synecho_reg_100.orf -o194_synecho_100.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY03330 108 Synechocystis Motif number 1 GGCAAACCTTTCTGGGGTAG 1 1 0 TCTGGGGTAG 0.988886 -108 TATCGCCAATTATCGGCAAACCTTTCTGGG 1 15 0 TATCGGCAAA 0.983511 -94 TGTGCTACGCTATCGCCAATTATCGGCAAA 1 25 0 TATCGCCAAT 0.959688 -84 TAGCACAATATATGGGGAAGGTGGCTGTCA 1 48 1 TATGGGGAAG 0.997514 -61 ACCAAGGGCCTGTGGGCAGGGGAATTGACA 1 73 0 TGTGGGCAGG 0.990211 -36 ********** Masking position 3 Map Score: 6.02807 Number of sites scoring better than the average of aligned sites = 659 Number in coding regions = 568 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 111 Fraction of orfs with sites within 600 bp upstream = 0.0178285 Motif number 2 GAATTGACAGCCACCTTCCCCATATATTGT 1 52 0 CCACCTTCCC 0.998605 -57 GGCTGTCAATTCCCCTGCCCACAGGCCCTT 1 70 1 TCCCCTGCCC 0.999034 -39 ********** Masking position 6 Map Score: 0.686308 Number of sites scoring better than the average of aligned sites = 134 Number in coding regions = 112 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0