AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i194_dna_replication_synecho_reg_300.orf -o194_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY03330 108 Synechocystis Motif number 1 CTACCCCAGAAAGGTTTGCC 1 1 1 CTACCCCAGA 0.988657 -108 CCCAGAAAGGTTTGCCGATAATTGGCGATA 1 15 1 TTTGCCGATA 0.983528 -94 TTTGCCGATAATTGGCGATAGCGTAGCACA 1 25 1 ATTGGCGATA 0.95941 -84 TGACAGCCACCTTCCCCATATATTGTGCTA 1 48 0 CTTCCCCATA 0.997482 -61 TGTCAATTCCCCTGCCCACAGGCCCTTGGT 1 73 1 CCTGCCCACA 0.990201 -36 ********** Masking position 8 Map Score: 6.02807 Number of sites scoring better than the average of aligned sites = 659 Number in coding regions = 568 Number in noncoding regions = 91 Number of orfs with sites within 600 bp upstream = 111 Fraction of orfs with sites within 600 bp upstream = 0.0178285 Motif number 2 ACAATATATGGGGAAGGTGGCTGTCAATTC 1 52 1 GGGAAGGTGG 0.998729 -57 AAGGGCCTGTGGGCAGGGGAATTGACAGCC 1 70 0 GGGCAGGGGA 0.999115 -39 ********** Masking position 5 Map Score: 0.686308 Number of sites scoring better than the average of aligned sites = 134 Number in coding regions = 112 Number in noncoding regions = 22 Number of orfs with sites within 600 bp upstream = 20 Fraction of orfs with sites within 600 bp upstream = 0.00321234 Motif number 3 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 1.37435e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0