AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i288_moxr_hypothetical_synecho_reg_300.orf -o288_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY23271 201 Synechocystis #2 RCY11277 49 Synechocystis #3 RCY18066 196 Synechocystis Motif number 1 GCTTTTCCAAAGATTTTCTCGGACTAGGTT 1 24 0 AGATTTTCTC 0.940666 -178 AATGGTACGACGCTTTTCCAAAGATTTTCT 1 35 0 CGCTTTTCCA 0.976755 -167 GAATTCCGATAGATTTTTCAATGGTACGAC 1 54 0 AGATTTTTCA 0.953422 -148 TTTGCAAAGGAGAATTTTCACAAAACTTCT 1 85 1 AGAATTTTCA 0.785796 -117 GTTGAAAGTGAATTTTTCCCTGGGCAGTCA 1 123 1 AATTTTTCCC 0.945663 -79 GAGTAAAGAAAGTTTTACCCACAAAGTTTC 3 14 1 AGTTTTACCC 0.965344 -183 TTTTGGCAATCAATTTACCAGAAACTTTGT 3 34 0 CAATTTACCA 0.809304 -163 GATTGCCAAAAGCTTTTCCCTGCTTTTTAT 3 53 1 AGCTTTTCCC 0.991575 -144 ********** Masking position 5 Map Score: 7.08876 Number of sites scoring better than the average of aligned sites = 2104 Number in coding regions = 1828 Number in noncoding regions = 276 Number of orfs with sites within 600 bp upstream = 292 Fraction of orfs with sites within 600 bp upstream = 0.0469001 Motif number 2 CTAGGTTAAAGACCAAGTTT 1 1 0 GACCAAGTTT 0.892473 -201 GATTTTCTCGGACTAGGTTAAAGACCAAGT 1 13 0 GACTAGGTTA 0.953113 -189 AAAACTTCTTGACCGGGGTTGAAAGTGAAT 1 106 1 GACCGGGGTT 0.976195 -96 TAGACTGACTGCCCAGGGAAAAATTCACTT 1 128 0 GCCCAGGGAA 0.97882 -74 TGGGCAGTCAGTCTAGGGTGTGATAGAGAG 1 143 1 GTCTAGGGTG 0.976995 -59 TCTAGTTCTCGACCAGTGGAGCAGATATT 2 10 0 GACCAGTGGA 0.944688 -40 CACCCGATGTGCCCAAGGTGACTGTGTATT 3 112 0 GCCCAAGGTG 0.985038 -85 TAGCGCCGCAGGCTAGGGGGATTTGGATAA 3 167 0 GGCTAGGGGG 0.976938 -30 ********** Masking position 3 Map Score: 6.27765 Number of sites scoring better than the average of aligned sites = 2963 Number in coding regions = 2717 Number in noncoding regions = 246 Number of orfs with sites within 600 bp upstream = 259 Fraction of orfs with sites within 600 bp upstream = 0.0415997 Motif number 3 ACGACGCTTTTCCAAAGATTTTCTCGGACTA 1 28 0 TCCAAAGTTT 0.915076 -174 GGAGAATTTTCACAAAACTTCTTGACCGGGG 1 93 1 CACAAAATTC 0.940893 -109 CTAGACTGTCCCCAATCATTCCAAC 2 35 1 CCCAATCTTC 0.981693 -15 AAGTTTTACCCACAAAGTTTCTGGTAAATTG 3 23 1 CACAAAGTTC 0.990374 -174 AAATTGATTGCCAAAAGCTTTTCCCTGCTTT 3 48 1 CCAAAAGTTT 0.915076 -149 ATTTGCGAATCCCATTGGTTCACCATTGATG 3 84 0 CCCATTGTTC 0.979819 -113 TAGCCTGCGGCGCTATGCTTCCCCT 3 182 1 CGCTATGTTC 0.932384 -15 ******* *** Masking position 9 Map Score: 3.36893 Number of sites scoring better than the average of aligned sites = 953 Number in coding regions = 861 Number in noncoding regions = 92 Number of orfs with sites within 600 bp upstream = 102 Fraction of orfs with sites within 600 bp upstream = 0.0163829 Motif number 4 CCTTTGCAAAGGAATTCCGATAGATTTTTC 1 65 0 GGAATTCCGA 0.985351 -137 GTGAACCAATGGGATTCGCAAATACACAGT 3 92 1 GGGATTCGCA 0.994565 -105 GCAGGCTAGGGGGATTTGGATAACAAATTA 3 160 0 GGGATTTGGA 0.991978 -37 ********** Masking position 4 Map Score: 0.0372895 Number of sites scoring better than the average of aligned sites = 58 Number in coding regions = 52 Number in noncoding regions = 6 Number of orfs with sites within 600 bp upstream = 7 Fraction of orfs with sites within 600 bp upstream = 0.00112432 Motif number 5 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -3.81261e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0