AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i340_weak11_synecho_reg_300.orf -o340_synecho_300.ace -a/home/amcguire/alignace/lib/ORF_synecho.txt -z/skink1/amcguire/genomes/synecho.fna -g0.48 -x5 -e Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.48 maxlen = 30 weight = 0.8 exclude = 1 Input sequences: #1 RCY10575 182 Synechocystis Motif number 1 GGTGATTAAAGGGCGATCGCCATTATAAAA 1 16 1 GGGCGATCGC 0.996969 -167 ATTTCCCCTGGGGCGAGGGGTAACTCACCT 1 45 0 GGGCGAGGGG 0.999001 -138 CCAGGGGAAATGGCAATGGGTTTATGCTCG 1 64 1 TGGCAATGGG 0.993166 -119 GGTTTAATCATGGTGACGGCCATAGCTAGT 1 117 1 TGGTGACGGC 0.983201 -66 AAATGTTCGATGGGGGTGTTAAGG 1 169 0 GTTCGATGGG 0.984313 -14 ********** Masking position 6 Map Score: 6.67981 Number of sites scoring better than the average of aligned sites = 1881 Number in coding regions = 1733 Number in noncoding regions = 148 Number of orfs with sites within 600 bp upstream = 185 Fraction of orfs with sites within 600 bp upstream = 0.0297141 Motif number 2 GGCTTGGTGATTAAAGGGCGATCGCCA 1 8 1 TGATTAAAGG 0.991986 -175 GCGATCGCCATTATAAAAGGTGAGTTACCC 1 28 1 TTATAAAAGG 0.943586 -155 GGAGCAGTATTGATTGGAGCGAGCATAAAC 1 83 0 TGATTGGAGC 0.973664 -100 GCCGTCACCATGATTAAACCAACGGGAGCA 1 107 0 TGATTAAACC 0.990263 -76 TCCAAATTTCTGCTAAAACCTATCCTTAAC 1 146 1 TGCTAAAACC 0.975071 -37 ********** Masking position 4 Map Score: 4.27382 Number of sites scoring better than the average of aligned sites = 294 Number in coding regions = 254 Number in noncoding regions = 40 Number of orfs with sites within 600 bp upstream = 53 Fraction of orfs with sites within 600 bp upstream = 0.00851269 Motif number 3 CCTGGGGCGAGGGGTAACTCACCTTTTATA 1 39 0 GGGGTAACTC 0.963949 -144 CCTCGCCCCAGGGGAAATGGCAATGGGTTT 1 57 1 GGGGAAATGG 0.933042 -126 AAATGGCAATGGGTTTATGCTCGCTCCAAT 1 71 1 GGGTTTATGC 0.991544 -112 CTGCTCCCGTTGGTTTAATCATGGTGACGG 1 106 1 TGGTTTAATC 0.922351 -77 TGTTAAGGATAGGTTTTAGCAGAAATTTGG 1 147 0 AGGTTTTAGC 0.896769 -36 GTTCGATGGGGGTGTTAAGGATAGGTTTTA 1 159 0 GGTGTTAAGG 0.958947 -24 ********** Masking position 2 Map Score: 1.48203 Number of sites scoring better than the average of aligned sites = 3320 Number in coding regions = 2971 Number in noncoding regions = 349 Number of orfs with sites within 600 bp upstream = 359 Fraction of orfs with sites within 600 bp upstream = 0.0576614 Motif number 4 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: 2.227e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0