AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i026_Fumarate_Reductase_ecoli_reg_300.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 frdA 294 fumarate reductase, anaerobic, flavoprotein subunit Motif number 1 CTGCCCACCGCTGTTTGATTCCTGCGTAAA 1 44 0 CTGTTTGATT 0.897495 -251 AAAGCACGATCTGATGGTTTAGTAATTAAA 1 83 1 CTGATGGTTT 0.979237 -212 ATTATCACTGAAGATGATTAATTTAATTAC 1 104 0 AAGATGATTA 0.798308 -191 TTTAGTGCGCAAGAGGGCTAAATTATCACT 1 125 0 AAGAGGGCTA 0.908669 -170 ACAGTATAGTCTGATGGATAAGTCTGAAAT 1 172 0 CTGATGGATA 0.989951 -123 TATAAAGGAGCAGTGGAATAGCGTTCGCAG 1 208 1 CAGTGGAATA 0.932284 -87 AAGTACGTGGCTGTGGGATAAAAACAATCT 1 264 1 CTGTGGGATA 0.983658 -31 GACATTCCTCCAGATTGTTTTTATCCCACA 1 275 0 CAGATTGTTT 0.915161 -20 ********** Masking position 9 Map Score: 6.62357 Number of sites scoring better than the average of aligned sites = 2606 Number in coding regions = 2412 Number in noncoding regions = 194 Number of orfs with sites within 600 bp upstream = 217 Fraction of orfs with sites within 600 bp upstream = 0.0348538 Motif number 2 AAAAAGCACGATCTGATGGTTTAGTAATTA 1 81 1 ATCTGATGGT 0.98285 -214 TGATGGATAAGTCTGAAATTTGACGAGATC 1 161 0 GTCTGAAATT 0.930854 -134 CAACAGTATAGTCTGATGGATAAGTCTGAA 1 174 0 GTCTGATGGA 0.984419 -121 CAGGGTAAGTACCTGAAAGTTACGGTCTGC 1 234 0 ACCTGAAAGT 0.963577 -61 CAGGTACTTACCCTGAAGTACGTGGCTGTG 1 249 1 CCCTGAAGTA 0.947107 -46 GATAAAAACAATCTGGAGGAATGTC 1 280 1 ATCTGGAGGA 0.974901 -15 ********** Masking position 4 Map Score: 4.23421 Number of sites scoring better than the average of aligned sites = 765 Number in coding regions = 677 Number in noncoding regions = 88 Number of orfs with sites within 600 bp upstream = 100 Fraction of orfs with sites within 600 bp upstream = 0.0160617 Motif number 3 GAAGTCTACTCGCAACGCGACGGCGAGAC 1 10 1 TCGCAACGCG 0.976493 -285 TTTAGTCACTGCCCACCGCTGTTTGATTCC 1 52 0 GCCCACCGCT 0.996045 -243 GCGAACGCTATTCCACTGCTCCTTTATAGG 1 206 0 TTCCACTGCT 0.972671 -89 AGTTACGGTCTGCGAACGCTATTCCACTGC 1 217 0 TGCGAACGCT 0.962189 -78 ATTGTTTTTATCCCACAGCCACGTACTTCA 1 262 0 TCCCACAGCC 0.988085 -33 ********** Masking position 5 Map Score: 1.23777 Number of sites scoring better than the average of aligned sites = 1004 Number in coding regions = 961 Number in noncoding regions = 43 Number of orfs with sites within 600 bp upstream = 57 Fraction of orfs with sites within 600 bp upstream = 0.00915516 Motif number 4 CAGATCGTGCTTTTTTTAGTCACTGCCCAC 1 66 0 TTTTTTTAGT 0.985938 -229 GCACGATCTGATGGTTTAGTAATTAAATTA 1 86 1 ATGGTTTAGT 0.965626 -209 ACGAGATCGATTTTTTTAGTGCGCAAGAGG 1 139 0 TTTTTTTAGT 0.985938 -156 ********** Masking position 8 Map Score: 0.827287 Number of sites scoring better than the average of aligned sites = 27 Number in coding regions = 14 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 17 Fraction of orfs with sites within 600 bp upstream = 0.00273049 Motif number 5 ********** No masking Map Score: -4.02005e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 6 ********** No masking Map Score: -4.02005e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 7 ********** No masking Map Score: -4.02005e-14 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0