AlignACE version 2.2 July 7, 1998 /home/amcguire/bin/alignACE -i124_Multidrug_Resistance_Pump_1_ecoli_reg_100.orf -a/home/amcguire/alignace/lib/ORF_ecoli.txt -z/skink1/amcguire/genomes/ecoli.fna -g0.5 -x5 Parameter values: expect = 5 ncols = 10 npass = 1000 maxnpass = 100 nruns = 1000 maxnruns = 100 repeat = 15 maxreps = 3 nread = 500 ncycles = 1 fragment = 1 psfact = 0.1 gcback = 0.5 maxlen = 30 weight = 0.8 exclude = 0 Input sequences: #1 cof 87 orf, hypothetical protein #2 ybaO 65 putative LRP-like transcriptional regulator #3 mdlA 29 ATP-binding component of a transport system Motif number 1 TGATTGAGTATCACCTGATATATACGGAAG 1 49 0 TCACCTGATA 0.951946 -39 TCTGTGACACGGTTAATGGTGATT 1 74 0 TGACACGGTT 0.988971 -14 AACCGGGCAATTGCCCGGTGCTGGAAGGGA 2 16 0 TTGCCCGGTG 0.994809 -50 CACCGGGCAATTGCCCGGTTTTTTTTGCGT 2 26 1 TTGCCCGGTT 0.996948 -40 CGTTGTGTCCTGACCTGATTCTGGATAT 3 9 0 TGACCTGATT 0.989271 -21 ********** Masking position 9 Map Score: 5.70374 Number of sites scoring better than the average of aligned sites = 940 Number in coding regions = 862 Number in noncoding regions = 78 Number of orfs with sites within 600 bp upstream = 70 Fraction of orfs with sites within 600 bp upstream = 0.0112432 Motif number 2 AATAGTTAAATAATATTGTTCCGGGTTTAT 1 11 0 TAATATTGTT 0.968138 -77 TATACGGAAGTAATAGTGAATAGTTAAATA 1 29 0 TAATAGTGAA 0.988097 -59 GTGACACGGTTAATGGTGATTGAGTATCAC 1 65 0 TAATGGTGAT 0.991945 -23 ********** Masking position 3 Map Score: 1.13746 Number of sites scoring better than the average of aligned sites = 112 Number in coding regions = 99 Number in noncoding regions = 13 Number of orfs with sites within 600 bp upstream = 18 Fraction of orfs with sites within 600 bp upstream = 0.0028911 Motif number 3 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 4 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0 Motif number 5 ********** No masking Map Score: -1.11255e-13 Number of sites scoring better than the average of aligned sites = 0 Number in coding regions = 0 Number in noncoding regions = 0 Number of orfs with sites within 600 bp upstream = 0 Fraction of orfs with sites within 600 bp upstream = 0